Información

¿Es posible eliminar una hebra de ADN bicatenario in vivo?

¿Es posible eliminar una hebra de ADN bicatenario in vivo?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Supongamos que tenemos una secuencia de ADN de doble hebra en células humanas, digamos

… ATCGATATCGATATTGCAGAGCATAGCTATAA… TAGCTATAGCTATAAGCTCTCGTATCGATATT…

Ahora quiero partir una hebra, de modo que tenga

… ATC… TAA… TAGCTATAGCTATAAGCTCTCGTATCGATATT…

La distancia no es tan importante para mí, por lo que puede eliminar 20 pb o 1000. Por lo tanto, si necesito algo de PAM o algo así y no está cerca del sitio de eliminación de destino, simplemente me moveré en 5 'resp. 3 'en la dirección hasta que lo encuentre y me corte allí, siempre que se asegure de que tengo el sitio de destino monocatenario en ese momento.

¡Estaría muy agradecido de poder ayudarme aquí!


Tanto las tecnologías de edición de genes TALEN como ZFN utilizan un par de endonucleasas de una sola hebra que, en última instancia, conducen a una ruptura de la doble hebra. Sin embargo, Cas9 en la tecnología CRISPR-Cas corta ambas hebras de ADN (hay algunas enzimas Cas en ciertas especies bacterianas que cortan solo una hebra [ref]).


Imagen cortesía: http://www.xenbase.org/other/static/CRISPr.jsp

Entonces, si usa una sola unidad del par, puede cortar una hebra del ADN. Puede utilizar otra nucleasa para realizar un corte en otro sitio de la misma hebra. Esto todavía no conducirá a la eliminación de la secuencia de ADN entre los dos sitios de corte. No hay tecnología disponible que pueda hacer esto. en vivo. Posiblemente (una suposición salvaje), puede usar un oligonucleótido modificado (o incluso un ARN sintetizado por IVT) que puede unirse a este tramo de secuencia y romper su interacción con la otra cadena de ADN. En cualquier caso, un tramo de ssDNA no sería estable y sería reparado rápidamente por la polimerasa.


El nuevo método de & ldquoPrime Editing & rdquo solo hace cortes de ADN de una sola hebra

Emma Yasinski
21 de oct de 2019

Una nueva técnica de edición de genes llamada edición principal, probada en células humanas y de ratón, reescribe el ADN cortando solo una hebra para agregar, eliminar o reemplazar pares de bases. El método puede permitir a los investigadores editar más tipos de mutaciones genéticas que los enfoques de edición del genoma existentes, como CRISPR-Cas9, informan los investigadores hoy (21 de octubre) en Naturaleza.

Emma Haapaniemi, líder de grupo en el Centro de Medicina Molecular de Noruega que estudia la edición de genes para tratar enfermedades raras y no formó parte del trabajo para desarrollar la edición de primera, dice El Científico que el enfoque es "innovador y novedoso", aunque, por supuesto, la técnica es "todavía un prototipo" y deberá perfeccionarse.

El descubrimiento de que CRISPR-Cas9 podría aprovecharse y utilizarse para editar genes animales y humanos marcó el comienzo de una nueva era de investigación genética en los últimos años. La técnica se ha convertido en una herramienta indispensable en muchos laboratorios de investigación, lo que permite a los científicos crear más fácilmente modelos animales de enfermedades genéticas. Si bien CRISPR-Cas9 se ha abierto camino hacia la clínica, su uso práctico para curar enfermedades humanas se ha visto limitado por consideraciones éticas, desafíos con la entrega y precisión, en particular, los llamados efectos fuera del objetivo que alteran el ADN en lugares no deseados. en el genoma.

Se sabe que el sistema de edición de genes CRISPR-Cas9 produce cortes adicionales en secciones incorrectas de ADN, lo que puede interrumpir la función celular. Otro tipo de edición de genes que no depende de las roturas del ADN y que se pensaba que minimizaba la inexactitud es la edición de bases, en la que una enzima puede intercambiar una nucleasa de ADN por otra, pero esta estrategia ofrece opciones limitadas ya que solo puede producir cuatro de las 12 posibles cambios de pares de bases, y algunos trabajos recientes han sugerido que no es tan preciso como los científicos pensaron en un principio.

Cuando el postdoctorado y autor principal del estudio, Andrew Anzalone, se unió al laboratorio de David Liu en el Broad Institute, que previamente desarrolló la técnica para la edición de bases, estaba especialmente emocionado por la posibilidad de editar genes sin usar roturas de ADN.

Entonces, basándose en lo que los dos sabían sobre la edición de bases y CRISPR-Cas9, comenzaron a trabajar en una nueva técnica para cortar solo una hebra de ADN, dejando la otra intacta. Utiliza la misma nucleasa Cas9 que se implementa con frecuencia en el sistema CRISPR, pero combina la enzima con dos nuevos reactivos: un ARN guía llamado pegRNA, que lleva a Cas9 al lugar deseado en el genoma, y ​​una transcriptasa inversa que inicia la adición de un nuevo secuencia o base en el genoma. Una vez que el nuevo material genético se incorpora a la hebra cortada de ADN, el editor principal corta la hebra sin editar, indicando a la célula que la reconstruya para que coincida con la hebra editada.

El equipo probó la edición principal in vitro en cuatro tipos diferentes de neuronas de células humanas y de ratón.

"Lo que observamos fue bastante notable", dijo Liu en una conferencia de prensa. Para comparar su precisión con CRISPR-Cas9, el equipo utilizó su tecnología para editar cuatro mutaciones genéticas. Estudios anteriores habían demostrado que cuando CRISPR-Cas9 se dirigía a estas mismas mutaciones, provocaba cambios de ADN fuera del objetivo en 16 ubicaciones predecibles. La edición principal solo alteró tres de estos loci, lo que sugiere que es más precisa que CRISPR-Cas9.

La edición principal es más compleja que la edición CRISPR. Requiere tres pasos separados en los que el ADN debe coincidir con partes del sistema de edición principal. Liu dice que cree que este podría ser el secreto de su precisión. CRISPR-Cas9 se basa en un paso de emparejamiento: el ARN guía debe emparejarse con el ADN objetivo. La edición principal requiere este primer paso, pero también incluye dos componentes más, una parte del ARN guía llamado cebador también debe unirse al sitio objetivo y el ADN recién introducido debe unirse al sitio original. "Si alguno de esos tres eventos de emparejamiento de ADN falla, la edición principal no puede continuar", dice Liu. “Creemos que esos tres eventos de emparejamiento independientes brindan una oportunidad para rechazar secuencias fuera del objetivo”, agrega.

Nicholas Katsanis, que estudia medicina genética en el Hospital de Niños de Chicago, dice que "no se puede negar que hay algún efecto fuera del objetivo [con CRISPR-Cas9], pero el miedo a los efectos fuera del objetivo es más que la realidad". No obstante, está entusiasmado con la nueva herramienta y "enamorado" de algunos aspectos de la nueva tecnología, como su capacidad potencial para editar una mayor diversidad de objetivos que otros métodos de edición de genes.

Liu y su equipo utilizaron la edición principal para apuntar a los genes subyacentes a la enfermedad de Tay-Sachs y la anemia de células falciformes. Las mutaciones se cambiaron de nuevo a secuencias de ADN saludables con una eficiencia del 35 al 55 por ciento, similar a las tasas que probablemente se lograrían con la edición CRISPR-Cas9.

El Broad Institute ha otorgado la licencia de la técnica a Prime Medicine, una empresa cofundada por Liu, bajo el modelo de "innovación inclusiva" del instituto, que permite a Prime utilizar la tecnología exclusivamente para apuntar a ciertos objetivos, pero ofrece a otras empresas la oportunidad de solicitar la licencia. para editar otros genes. El grupo de Liu también ha puesto la técnica a disposición en la base de datos de Addgene para uso académico. "Tengo la esperanza de que cientos, si no miles, de investigadores intentarán utilizar la edición principal en las próximas semanas, meses y años", dice Liu. "Es realmente importante que la comunidad pruebe y, si es necesario, optimice la edición principal en tantos tipos diferentes de células y organismos como sea posible".

A. Anzalone et al., "Búsqueda y reemplazo de la edición del genoma sin roturas de doble cadena o ADN del donante" Naturaleza, doi: 10.1038 / s41586-019-1711-4, 2019.

Emma Yasinski es una reportera independiente que vive en Florida. Síguela en twitter @ EmmaYas24.


Introducción

Las metiltransferasas de ADN establecen patrones de metilación en las células y transmiten estos patrones a lo largo de las generaciones celulares, lo que influye en los estados epigenéticos de cada célula. (Consulte [1] para obtener una descripción general de las metiltransferasas y el Material complementario de [2] para una introducción a la metilación del ADN dirigida a no biólogos). Se han identificado tres ADN metiltransferasas primarias en mamíferos: DNMT1, DNMT3A y DNMT3B [3], [4]. Mientras que los DNMT3 son principalmente responsables de establecer patrones de metilación durante el desarrollo temprano y, por lo tanto, se conocen comúnmente como metiltransferasas de novo, DNMT1 es principalmente responsable de mantener los patrones de metilación existentes en las divisiones de células somáticas y, por lo tanto, se conoce comúnmente como metiltransferasa de mantenimiento [1]. .

Un componente central del modelo ampliamente aceptado para el mantenimiento de la metilación del ADN en eucariotas son las acciones procesivas de la metiltransferasa de mantenimiento DNMT1 en las díadas CpG hemimetiladas poco después de la replicación del ADN (Figura 1 [1]). Este modelo se basa en dos propiedades de DNMT1: especificidad del sustrato (es decir, actuar de diferentes maneras o a diferentes velocidades en diferentes tipos de sustrato) y procesividad (es decir, asociarse consecutivamente en múltiples sitios a lo largo del ADN). Estas son propiedades clave de las metiltransferasas de ADN y de muchas otras enzimas de unión al ADN [1], [5], y ambas propiedades se han investigado exhaustivamente in vitro.

Las hebras hijas recién sintetizadas (rojas, en su mayoría, y verde pálido) inicialmente no están metiladas. Después de la replicación del ADN, DNMT1 (púrpura) se une a las díadas CpG hemimetiladas, quizás con la ayuda del complejo de proteínas de replicación (amarillo), que incluye proteínas PCNA y UHRF1 [1]. Se propone que DNMT1 se mueva procesivamente a lo largo de la molécula desde el extremo 5 & # x02032 hasta el extremo 3 & # x02032 de la hebra hija. Tenga en cuenta que la díada CpG más a la izquierda en la parte superior está hemimetilada, porque DNMT1 aún no la ha alcanzado. La metilación por DNMT1 no es perfecta (por ejemplo, el CpG en verde pálido permanece sin metilar), porque DNMT1 no agrega grupos metilo (indicados por la letra M) a sus díadas CpG asociadas, o no está asociado con el ADN en esos sitios.

Con respecto a la especificidad del sustrato, los experimentos in vitro muestran que DNMT1 agrega preferentemente grupos metilo a las citosinas en CpG de cadena hija que se emparejan con CpG de cadena madre metilada, en lugar de no metilada (es decir, díadas CpG hemimetiladas), manteniendo así la metilación en estos sitios CpG a lo largo de generaciones de células [6]. Dicha preferencia por las díadas CpG hemimetiladas se predijo para las metiltransferasas de mantenimiento ya en 1968 [7], y ahora se mide comúnmente en términos de la & # x0201 relación de preferencia química & # x0201d. Esta relación representa las velocidades relativas con las que una enzima metila las díadas CpG hemimetiladas y no metiladas. Las estimaciones informadas para DNMT1 en humanos y ratones, generalmente de experimentos in vitro, varían ampliamente de 2 a 200 veces, dependiendo del contexto de la secuencia de ADN, las condiciones experimentales y la preparación de la enzima [6].

Con respecto a la procesividad, los experimentos in vitro sugieren que la DNMT1 de ratón actúa de forma procesiva, uniéndose al ADN y luego permaneciendo activa durante un tramo de nucleótidos consecutivos [1], [6]. Se ha encontrado que los ortólogos humanos y de ratón de DNMT1 se asocian con la maquinaria de replicación del ADN, que incluye proteínas PCNA y UHRF1 [8], [9]. Por tanto, las DNMT1 están preparadas para metilar citosinas poco después de su incorporación en la cadena de ADN hija naciente. Sin embargo, los experimentos indican que tanto los ortólogos humanos como los de ratón también pueden modificar de forma procesiva díadas hemimetiladas en ADN sintéticos en ausencia de la maquinaria de replicación [10] & # x02013 [14]. Este resultado sugiere que la interacción de los ortólogos humanos y de ratón con la maquinaria de replicación puede no ser esencial para las actividades enzimáticas.

Las metiltranferasas de novo DNMT3A y 3B [4] también son importantes en la preservación de estados epigenéticos apropiados en células somáticas humanas y de ratón [15]. La ausencia de estas metiltransferasas puede dar lugar a fenotipos anormales [16], [17]. Los experimentos in vitro también han investigado la especificidad del sustrato y la procesividad de estas enzimas. En cuanto a la especificidad del sustrato, a diferencia de DNMT1, ni DNMT3A ni 3B muestran preferencia por añadir grupos metilo a las díadas CpG hemimetiladas sobre las díadas no metiladas [4], [18]. Los estudios de la posible procesividad de los DNMT3 son menos extensos que los de DNMT1. Los experimentos in vitro han demostrado un comportamiento no procesivo de DNMT3A de ratón, pero un comportamiento altamente procesivo de DNMT3B de ratón [19], y un comportamiento procesivo de DNMT3A humano [20].

A pesar de la disponibilidad de importantes datos in vitro, quedan por abordar cuestiones importantes con respecto a las propiedades in vivo de las ADN metiltransferasas. Aquí, investigamos las preferencias de sustrato in vivo y los niveles de procesividad de DNMT1 y DNMT3 humanos mediante el análisis de patrones de metilación de ADN bicatenario establecidos in vivo, medidos mediante PCR horquilla-bisulfito [21], [22]. Los análisis previos de algunos de estos patrones bicatenarios [2], [23] arrojaron estimaciones de las tasas específicas de sitio CpG de metilación de mantenimiento y metilación de novo de las cadenas madre e hija. Sin embargo, estos análisis previos tenían como objetivo cuantificar el resultado del proceso de metilación, sin considerar las enzimas involucradas. Aquí, desarrollamos un nuevo modelo de Markov oculto (HMM) para dar cuenta de las propiedades de los DNMT responsables del proceso de metilación. Nuestro HMM incluye parámetros que capturan tanto la especificidad del sustrato como la procesividad de cada enzima y, por lo tanto, permite la inferencia de estos parámetros a partir de los datos observados. Además de estos análisis in vivo, también aplicamos el HMM (adecuadamente modificado) para volver a analizar varios conjuntos de datos in vitro publicados y compararlos con nuestros resultados in vivo.

Una característica importante de nuestros análisis es que se basan en un modelo estadístico, que cuantifica la procesividad como probabilidad, lo que permite contrastar estadísticamente si existe procesividad, y que evalúa la incertidumbre estadística en la estimación de esta probabilidad, facilitando así la comparación de valores inferidos. niveles de procesividad entre conjuntos de datos. Nuestro HMM también explica explícitamente los posibles errores de medición en los datos observados, estos errores generalmente no se han tenido en cuenta en otros estudios in vivo e in vitro. Además, este HMM también se puede utilizar para inferir el conjunto de actividades enzimáticas que muy probablemente dieron lugar a cada patrón de metilación observado, y para inferir, probabilísticamente, qué hebra en cada patrón de metilación de doble hebra es la hebra madre y cuál es la hebra madre. hebra hija (esta información no se puede medir directamente en el experimento horquilla-bisulfito), lo que permite la investigación del comportamiento específico de hebra de estas enzimas (Figura 2).

Cada patrón contiene un par de hebras madre e hija que es la hebra madre y cuál es la hebra hija no se conoce directamente. Nuestro HMM infiere probabilísticamente las asignaciones de hebras para cada patrón. Estas probabilidades posteriores se muestran en verde para la asignación de hebras padre e hija indicadas (indicadas por las letras P y D en verde). Estos patrones de nuestro FMR1 los datos contienen series largas de díadas CpG hemimetiladas con sus grupos metilo presentes en la misma hebra. Las dos explicaciones más probables, entre todas posibles explicaciones, se muestran para cada patrón. Los símbolos indican posibles estados y actividades de las metiltransferasas. Aquí no se utilizan todos los símbolos. El efecto de estos cuatro patrones en la estimación de parámetros se muestra con más detalle en la Figura complementaria 13 en Materiales S1.


Resultados

Un modelo de Markov oculto (HMM) para la procesividad y otras propiedades de los DNMT

Modelamos los patrones de metilación bicatenarios observados como si hubieran surgido de un proceso en el que las metiltransferasas (DNMT1 y DNMT3) estaban asociadas o no asociadas con el ADN en un sitio CpG. Modelamos estos estados de asociación / no asociación como un proceso de Markov a lo largo del ADN. El modelo para los datos observados basado en estos estados no observados ("ocultos") es entonces un Modelo Oculto de Markov (HMM [24]). Para los datos in vivo, no podemos descartar que otras enzimas (quizás no identificadas) además de DNMT1 y las DNMT3 también pueden haber contribuido a los patrones de metilación observados. Para permitir esto, nuestras referencias a DNMT1 podrían interpretarse ampliamente como referencias a las enymes cuyas actividades son principalmente metilación de mantenimiento, y las referencias a DNMT3s podrían interpretarse ampliamente como enzimas cuyas actividades son principalmente metilación de novo.

Más específicamente, el proceso de Markov oculto en el HMM se puede descomponer en tres procesos de Markov independientes: el primero representa la asociación de DNMT1, que suponemos que actúa solo en la cadena hija [10], el segundo representa la asociación de los DNMT3 en el hebra parental, y la tercera representa la asociación de los DNMT3 en la hebra hija. Usamos los subíndices y para referirnos a cada uno de estos procesos. Caracterizamos cada proceso de Markov mediante dos probabilidades de transición: la probabilidad de reasociación por pb, de que las moléculas no asociadas de la metiltransferasa se asocien con el ADN en más de 1 pb, y la probabilidad de disociación por pb, de que las moléculas asociadas de la metiltransferasa se desasocien del ADN durante 1 pb. La matriz de probabilidad de transición sobre 1 pb para cada proceso de Markov se puede escribir como en la Ec. (1). (1) La matriz de probabilidad de transición entre dos sitios CpG bp separados es entonces.

Bajo esta parametrización, dos eventos contribuyen a la probabilidad de que una metiltransferasa permanezca asociada en dos sitios consecutivos separados por 1 pb (es decir, la entrada inferior derecha en): (i) procesividad, por la cual la metiltransferasa permanece asociada desde el sitio 1 al sitio 2 sin nunca disociarse del ADN. Esto sucede con eventos de probabilidad y (ii) de disociación-reasociación, en los que la metiltransferasa se asocia en el sitio 1, luego se “cae”, pero se vuelve a asociar con el ADN en el sitio 2. Esto sucede con probabilidad. Cuantificamos la fuerza de la procesividad, que corresponde al evento (i), por la probabilidad de disociación: el valor corresponde a "sin procesividad", donde la metiltransferasa se disocia del ADN en cada par de bases y el estado de asociación es independiente en cada sitio (es decir, , las dos filas de son idénticas) los valores de corresponden al comportamiento procesivo, y cuanto menor es el valor de, más fuerte es la procesividad. Este parámetro se traduce en la longitud esperada de cada tramo de asociación de pb, que es una medida más convencional de procesividad y cuantifica la procesividad directamente en términos de longitud del tramo. Debido a que se refiere solo a moléculas de enzima que ya están asociadas, esta longitud media de los tramos de asociación excluye múltiples eventos de disociación-reasociación en sitios CpG consecutivos, que podrían confundirse con procesividad. De manera similar, la longitud esperada de los tramos de no asociación, que son espacios entre los tramos de asociación, tiene una media de pb. A diferencia, la probabilidad de reasociación podría estar impulsada principalmente por concentraciones de moléculas de metiltransferasa no asociadas en el núcleo.

Los parámetros y juntos determinan la frecuencia media con la que la metiltransferasa se asocia con el ADN en cada sitio CpG. Usando para denotar esta frecuencia, tenemos (2)

Además de estos parámetros relacionados con la procesividad, nuestro modelo también tiene parámetros para las actividades de metilación de las metiltransferasas cuando están asociadas con el ADN, y parámetros para los errores de medición que pueden resultar de la conversión de bisulfito (consulte Materiales y métodos para obtener más detalles). Juntos, estos parámetros, las "probabilidades de emisión" del HMM, describen cómo los estados de asociación o no asociación de las metiltransferasas dan lugar a estados de metilación observados en los pares de hebras madre e hija, sujeto a errores de medición (consulte Materiales y métodos para obtener más detalles). . Permitimos que las metiltransferasas metilen CpG hijas en sitios hemi-metilados asociados con probabilidad de DNMT1 (o para DNMT3) y en sitios asociados no metilados con probabilidad de DNMT1 (o para DNMT3). Las relaciones y se denominan "relaciones de hemi-preferencia" para DNMT1 y DNMT3, respectivamente. Para la cadena madre, hacemos la suposición más simple de que los DNMT3 siempre agregan un grupo metilo al CpG asociado.

El modelo anterior es muy general, lo que permite una combinación compleja de comportamientos de las metiltransferasas. En las aplicaciones, puede ser útil restringir este modelo de varias maneras, ya sea para tratar los datos recopilados de condiciones experimentales particulares o para hacer que los parámetros sean más identificables. Por ejemplo, imponer la restricción produce un modelo más parsimonioso en el que los DNMT3 siempre metilan el CpG de la cadena hija asociada. Este es el modelo que usamos para la mayoría de los análisis presentados aquí. Sin embargo, para intentar estimar la relación de hemi-preferencia para los DNMT3, imponemos una restricción diferente sobre el modelo general. Esta restricción refleja la configuración en la que DNMT1 es la enzima de mantenimiento principal y ayuda a distinguir el proceso de DNMT1 y el proceso de hebra hija de los DNMT3, que de otro modo no se podrían distinguir (consulte Materiales y métodos para obtener más detalles). Para analizar los datos in vitro sobre DNMT1 bajo el mismo modelo, estimamos los parámetros solo asociados con el proceso DNMT1, y fijamos las probabilidades de reasociación y para ser 0 y las probabilidades de disociación y para ser 1 estas restricciones reflejan el entorno in vitro donde los DNMT3 Están ausentes.

Ajustamos el HMM a los datos en un marco de inferencia bayesiano [25], utilizando la cadena de Markov Monte Carlo (MCMC) para producir muestras de la distribución posterior conjunta de todos los parámetros en el modelo dados los datos (consulte Materiales S1 para obtener detalles, incluida la especificación de distribuciones anteriores relevantes). En el núcleo de nuestra implementación se encuentra el algoritmo estándar de retroceso y retroceso en cada iteración de MCMC para calcular la probabilidad conjunta de los parámetros dados los patrones de metilación observados. La complejidad computacional del algoritmo hacia adelante y hacia atrás para todos los patrones en los sitios CpG en cada iteración de MCMC es, donde 8 () es el número de estados ocultos en cada sitio, siendo 2 los dos estados (asociados y no asociados) de cada proceso de Markov. . Resumimos las distribuciones posteriores de los parámetros de la inferencia bayesiana por la mediana posterior y los intervalos creíbles del 80% (IC del 80%, percentiles 10 y 90) Se utilizaron intervalos del 80%, en lugar de intervalos más convencionales del 95%, para reducir el impacto. de las pesadas colas de algunas distribuciones. Este procedimiento de inferencia da cuenta de la incertidumbre en los datos con respecto a qué actividades enzimáticas produjeron cada patrón bicatenario observado mediante el uso de un algoritmo de programación dinámica para sumar todas las posibilidades, ponderando cada posibilidad por su probabilidad (Figura 2, ver también Materiales S1).


Afiliaciones

Departamento de Biología, ETH Zurich, Zurich, Suiza

Charles D. Yeh y Jacob E. Corn

Departamento de Biología Molecular, Celular y del Desarrollo, Universidad de California, Santa Bárbara, Santa Bárbara, CA, EE. UU.

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

Autor correspondiente


Selección de plásmidos recombinantes

Al crear plásmidos recombinantes y transformar bacterias con ellos, podemos terminar con bacterias tanto con la versión recombinante como con la versión original del plásmido. Sin embargo, es posible que deseemos seleccionar solo el plásmido recombinante. En algunos casos, esto es natural y podemos hacerlo simplemente seleccionando la propiedad que nos da el plásmido recombinante.

A menudo, sin embargo, necesitaremos utilizar técnicas más avanzadas para seleccionar el plásmido recombinante. Para hacer esto, podemos agregar un segundo gen de interés, que luego podemos usar para seleccionar nuestro plásmido. Por ejemplo, podemos agregar un gen para una resistencia específica a un antibiótico y luego, podemos cultivar nuestras bacterias transformadas en ese antibiótico. Las bacterias que tienen el plásmido original morirán, mientras que nuestras células bacterianas transformadas (que tienen ese gen extra) serán seleccionadas.

También podemos hacer cosas similares con otros genes. Por ejemplo, podríamos insertar un gen fluorescente como GFP. Una vez que las colonias crecen, podemos examinarlas visualmente y seleccionar las que exhiben la fluorescencia que queremos. De esta manera, podemos seleccionar solo las colonias que tienen nuestro plásmido.


Falta de coincidencia de ADN

Desajuste de ADN incorrecto que podría ocurrir recombinación durante la inserción y sistema de reconocimiento erróneo desacoplamiento de ADN y replicación de ADN, inserción y corrección de reparación de una forma particular de daño en el ADN.

La reparación de desajustes es una forma específica de hebra. Durante la síntesis de ADN, normalmente se incluye el error de las hebras recién sintetizadas. Para hacer esta máquina de reparación de desajustes, está equipada con una cadena que se sintetiza de novo a partir de la plantilla (principal). Yo distingo (no la hija y la metilación del padre) Hemimetilación transitoria, hebra en bacterias Gram-negativas. En eucariotas y otros procariotas, el mecanismo exacto no está claro. Esto, en eucariotas, (antes de que sea sellado por ADN ligasa) Nick temporal puede incluir una señal que indique un sistema de corrección de desajustes en cada cadena si se sospecha que el ADN de la hebra rezagada se sintetiza de novo. Hackear estos Esto significa que la evidencia presente en la cadena superior debe haber sido descubierta recientemente. En un estudio reciente, el apodo específico de la dirección, el sitio, como la forma de rosquilla del contacto de la proteína terminal 3 & # 8242-OH Nick, es que en un lado, se ha mostrado la carga dependiente de RFC de replicación de PCNA de abrazadera deslizante. El PCNA orientado dirige la acción de la endonucleasa MutLalpha de una hebra en presencia de MutSbeta o MutSalpha y no cumple.

La violación de la estructura de superhélice del ADN, cada evento de mutación, conlleva el potencial genético de amenazar la estabilidad de la célula. El hecho de reparar el sistema y la detección de daños es que es complicado replicar la evolución de la máquina, destacando fielmente la importancia que se le da al ADN. Ejemplos de bases mal emparejadas y similares (ver reparación del ADN) emparejamiento o G / T en / C. La discrepancia se debe a la tautomería de la síntesis de bases cuando es frecuente. El daño se realiza colocando la hebra sin plantilla y la plantilla, para reconocer la deformación causada por el desajuste, para encenderla por error, cortar y reemplazar con el nucleótido correcto. Proceso de eliminación, que incluye una base no coincidente mucho más que simplemente. Es posible eliminar los miles a varios pares de bases de la cadena de ADN recién sintetizada.

La reparación del desajuste de ADN (MMR) es un proceso que se conserva evolutivamente para corregir el desajuste generado durante la edición del escape y la replicación del ADN. Además de las proteínas MMR, es posible que tengan una amplia gama de efectos biológicos que pueden inactivar la MMR es perjudicial o beneficiosa, para participar en el ADN de muchas otras operaciones. Describimos brevemente el impacto del deterioro y muchas características de la proteína MMR para comenzar esta revisión. Luego, me enfocaré en el mecanismo bioquímico de la MMR de los errores de replicación. En los estudios funcionales & # 8211 estructura de la proteína MMR cómo reconocer un proceso de conflicto para identificar una nueva redirección para cortar el error de clave duplicada.

Al corregir las discrepancias que se generaron durante la replicación del ADN, reparación de errores de apareamiento de ADN (MMR), que proporciona fidelidad de replicación. Cómo se produce in vivo, la MMR se reconstituye con in vitro, pero la MMR humana no está clara. Aquí, mostramos que la histona marca H3K36me3 epigenética, para reclutar el reconocimiento de desajustes de proteínas hMutSα (of-hMSH6 hMSH2) de, y se requiere cromatina in vivo a través de una interacción directa con el dominio PWWP de hMSH6 que. La abundancia de S H3K36me3 está garantizada antes de que se introduzcan pares erróneos de cromatina hMutSα entre la replicación del ADN que se enriquece temprano y G1. En las células que carecen de H3K36 trimetiltransferasa SETD2 muestran inestabilidad de microsatélites (MSI), aumenté la frecuencia de mutación espontánea característica de las células deficientes en MMR y. Este trabajo demuestra que las células cancerosas MSI-positivas descritas marcadas con histonas para ajustar la MMR en células humanas, no tienen una mutación detectable en el gen conocido como MMR, un enigma durante muchos años.

En E. coli en el sistema MMR dirigido por metilo se ha estudiado ampliamente, toda la ruta se reconstituye con in vitro de proteína purificada en el laboratorio Modri ​​ch. La MMR en procariotas se inicia cuando es reconocida por MutS en MMR, o proteínas que son desviaciones muy conservadas. Al activar las proteínas, las proteínas MMR se guardan y la segunda de MutS, Mut1, en tercer lugar, la escisión por endonucleasa de Muth, y actúan en concierto para autorizar la vía de reparación de la escisión. Instruiré sus actividades para apuñalar la cadena no metilada en la replicación después del sitio transitorio hemi CATC, en breve Azimut. MMR en E. coli, asegúrese de que está apuntando a la cadena de ADN recién sintetizada que contiene el error es esta punción de Azimut con metilo. El estudio de la in vitro ha ayudado a establecer una comunicación bidireccional con el proceso de corte de MMR. En otras palabras, MMR puede usarse con apodos en ambos lados del espacio. Puedo actuar como puerta de entrada para la generación de helicasa II y Mutl, un proceso que se facilita en la cadena naciente, mediante la unión de la proteína monocatenaria que es esta participación en la cadena naciente. RecJ ExoI, ExoVII o ExoX: se coloca en la dirección de una de las digestiones con exonucleasa de 4 hebras que tiene un polar 5 & # 8242-3 & # 8216 o 3 & # 8242-5 & # 8217. El ADN reparará la diferencia de reacción que involucra la restauración de ligasa y Pol III, ya que es el doble del genotipo del padre.


Propiedades

Especificidad hacia el ADN bicatenario
Se ha probado la especificidad del ácido nucleico frente a oligonucleótidos de ADN y ARN bicatenarios y monocatenarios.

La especificidad de la dsDNase hacia el sustrato se ha medido utilizando oligonucleótidos de 15 meros con FAM en 5 & prime y DarkQuencher & reg 3 & prime (Eurogentec). La fluorescencia es proporcional a la actividad enzimática.

Condiciones del ensayo: Tris 25 mM pH 7,5, MgCl 5 mM2y oligonucleótido 2 & muM.

Actividades relativas
Sustrato Actividad relativa
dsDNA 100%
ssDNA & lt 0.03%
dsRNA & lt 0.01%
ssRNA & lt 0.01%

A partir de los datos anteriores, podemos concluir que la dsDNase es específica de doble hebra.

DsDNase

Inactivación por calor
La dsDNasa puede inactivarse por calor mediante tratamiento térmico a 15 min a 65 ° C o 20 min a 60 ° C. La enzima requiere DTT 1 mM y pH & ge 8 para una inactivación completa.

Especificaciones

  • Definición de unidad
    Una unidad se define como un aumento en la absorbancia a 260 nm de 0,001 por minuto, usando 50 μg / ml de ADN de alto PM en acetato de sodio 100 mM pH 5,0 y MgCl2 5 mM.
  • Actividad específica
    California. 400 000 Unidades Kunitz / mg.
  • Actividad
    La dsDNase es muy activa en un rango de temperatura de 20-40 ° C. Necesita al menos 2,5 mM de Mg para su actividad y tiene un pH óptimo a 7,5.
  • Búfer de almacenamiento
    Tris-HCl 20 mM, pH 7,5, MgCl2 2 mM, NaCl 10 mM, Triton X-100 al 0,01% (v / v), glicerol al 50% (v / v).
  • Pureza
    La dsDNasa se purifica hasta una aparente homogeneidad.
  • Requisito de muestra
    Purificación de ácidos nucleicos previa al tratamiento con dsDNasa.
  • Almacenamiento
    La vida útil mínima es de 3 años a -20 ° C. El almacenamiento a 4 ° C es posible durante al menos 6 meses. La enzima también tolera múltiples ciclos de congelación-descongelación.

HL-dsDNase

Inactivación por calor
La HL-dsDNasa se puede inactivar por calor mediante tratamiento térmico a 5 min a 58 ° C. La enzima requiere DTT 1 mM y pH & ge 8 para una inactivación completa.

Especificaciones

  • Definición de unidad
    Una unidad se define como un aumento en la absorbancia a 260 nm de 0,001 por minuto, usando 50 μg / ml de ADN de alto PM en acetato de Na 100 mM pH 5,0 y MgCl2 5 mM.
  • Specific activity
    California. 200 000 Kunitz Units/mg.
  • Actividad
    The HL-dsDNase is highly active in a temperature range of 20-40°C. It needs at least 2.5 mM Mg for activity and has an optimal pH at 7.5.
  • Storage buffer
    20 mM Tris-HCl pH 7.5, 2 mM MgCl2, 10 mM NaCl, 0.01% (v/v) Triton X-100, 50% (v/v) glycerol.
  • Pureza
    HL-dsDNase is purified to apparent homogeneity.
  • Sample requirement
    Purification of nucleic acids prior HL-dsDNase treatment.
  • Almacenamiento
    Minimum shelf life is 2 years at -20°C. The enzyme also tolerates multiple freeze-thaw cycles.

Types of DNA polymerase.

Basically, the types of DNA polymerase are also divided depending on the organism that possess themi.e. eukaryotic and prokaryotic DNA polymerases. These types of DNA polymerase are classified based on their characteristics including structural sequences, and functions.

Prokaryotic DNA Polymerases

Prokaryotes contain five different types of DNA polymerase. These are described below.

ADN polimerasa I

Polymerase I is a DNA repair enzyme from the family A polymerases that has a 5’ to 3’ and 3’ to 5’ activity. Pol I account for more than 95% of polymerase activity in E. coli, although cells that lack this polymerase have been found and its activity can be replaced by the other four types of polymerase. This DNA polymerase has a poor processivity rate, adding around 15 to 20 nucleotides per second. Pol I begin the process of DNA elongation at a point called the “origin of replication” and about 400 base pairs downstream of this point, Pol III takes over replication, which it performs at a much higher speed.

ADN polimerasa II

Polymerase II is a DNA repair enzyme with a 3’ to 5’ exonuclease activity. Pol II is a family B polymerase and provides support to Pol III. When DNA acquires damage in the form of short gaps, which block Pol III activity, Pol II helps to remedy this problem by restarting DNA synthesis downstream of these gaps.

DNA Polymerase III

This holoenzyme is the main polymerase in E.coli DNA replication and is one of the family C polymerases. Polymerase III is made up of the clamp-loading complex, the beta sliding clamp processivity factor and the Pol III core. The core comprises three subunits – the α subunit which is the polymerase activity hub, the δ subunit which is the exonucleolytic proofreader, and the θ subunit which may stabilize δ. The core and the beta sliding clamp are present in duplicate, to allow for processing of both the leading and lagging DNA strands.

DNA Polymerase IV

This enzyme belongs to the Y family of DNA polymerases. Pol IV is an error-prone polymerase that has no 3’ to 5’ proofreading activity and is involved in mutagenesis or the altering of DNA to give rise to a mutation. The enzyme is expressed by a gene (dinB) that is switched on when polymerases stall at the replication fork. This interferes with the processivity of Pol III which acts as a checkpoint, stopping replication and allowing time for DNA to be repaired. Cells that lack dinB are at an increased risk of developing mutations caused by agents that damage DNA.

DNA Polymerase V

It belongs to Family Y, with high regulatory activity. It is produced only when DNA is damaged and it requires translesion synthesis. It also lacks exonuclease functions and hence it can’t proofread the synthesis of DNA replicas making it less efficient.

Eukaryotic DNA Polymerase

DNA Polymerase γ

Polymerase γ is a Type A polymerase, whose main function is to replicate and repair mitochondrial DNA.

It also functions by proofreading 3′ to 5′ exonuclease activity. Mutations on Poly γ significantly affect the mitochondrial DNA causing autosomal mitochondrial disorders.

DNA Polymerase α, δ, and ε

These are the type B Polymerase enzymes and they are the main polymerases applied in DNA replication.

Pol α works by binding to the primase enzyme, forming a complex, where they both play a role in initiating replication. Primase enzyme creates and places a short RNA primer which allows Pol α to start the replication process.

Pol δ starts the synthesis of the lagging strand from Pol α, while Pol ε is believed to synthesize the leading strand during replication. Studies indicate that Pol δ replicates both the lagging and leading strand. Pol δ and ε also have a 3′ to 5′ exonuclease activity.

DNA Polymerase β, μ, and λ

These are type 3 or Family X of polymerase enzymes. Pol β has a short-patch base excision repair mechanism where it repairs alkylated or oxidized bases.

Pol λ and Pol μ are important for rejoining DNA double-strand breaks due to hydrogen peroxide and ionizing radiation, respectively.

DNA Polymerases η, ι, and κ

They are type 4 or family Y polymerases majorly used in repairing of DNA by a mechanism known as translesion synthesis.

They are prone to errors during DNA synthesis. Pol η functions by accurately ensuring the translesion synthesis of DNA damages that is caused by ultraviolet radiation.

Pol κ is still understudies but one of its known functions is to extend or insert specific bases at certain DNA lesions. Translesion synthesis polymerases are activated by stalled replicative DNA polymerase.

Terminal deoxynucleotidyl transferase (TdT)

TdT functions by catalyzing the polymerization of deoxynucleoside triphosphate to the 3′-hydroxyl group of a preformed polynucleotide chain. TdT is a non-template directed DNA polymerase. It was first detected in the thymus gland.


Is it possible to remove one strand of double stranded DNA in vivo? - biología

The usefulness of DNA extends beyond carrying the hereditary material for living organisms. In the 1980s, researchers began to manipulate genetic strands&mdashwhich are composed of four nucleobases (A, C, T, G) that form base pair bonds&mdashto fold DNA (and, later, RNA) into predetermined structures. This includes scaffold-based DNA origami and DNA bricks. Such prototypes could eventually lead to nanoscale devices with real-world applications such as nanofabrication of molecular robots that deliver drugs upon contact with a target molecule molecular instruments that precisely position molecules or trigger interactions and molecular breadboards that organize hundreds of molecular components into specific arrangements with nanometer precision.

Until recently, DNA- and RNA-based structures have largely been limited to those built from multiple strands rather than single strands. To create such structures, researchers first synthesize a single-stranded DNA molecule called the scaffold and then add hundreds or thousands of individually synthesized shorter components. These bind to multiple locations on the scaffold, tying the molecule together and inducing folding. This complex assembly process makes the structures vulnerable to defects or missing strands, however, and necessitates time-consuming checks to ensure all pieces are correctly in place.

Now, as reported in a recent issue of Ciencias, researchers have bypassed those limitations by creating stable, self-folding single-strand DNA and RNA origami that is both simpler and less prone to defects than earlier multi-strand products. “This is really a new way of making complex nanostructures with user prescribed geometries,” says Peng Yin, a professor of Systems Biology at Harvard Medical School and the Wyss Institute at Harvard University, and a co-author on the work. “We demonstrated that uni-molecular folding of a single strand without other components can be a general platform to produce complex structures.”

The concept of one long DNA or RNA strand whose sequence dictates its own folding first emerged in 2014, when researchers created A-form helices&mdashone of the three biologically active double helical structures that DNA and RNA can adopt&mdashfrom single-stranded RNA. The molecular design process was fairly complex, however, and sizes were limited to just 660 nucleotides.

Yin and his colleagues expanded on that earlier work by first identifying molecular structures that would allow their single-stranded structure to self-assemble in a precise order, preventing tangles and knots from forming. A web-based automated software they created based on those findings provides researchers with a general platform for producing complex structures from a single long strand.

“This is a very important paper, because it is one of the few that addresses the folding of nucleic acid strands while being aware not merely of energetics, but the topology itself, so as to avoid knotting,” says Ned Seeman, the Margaret and Herman Sokol Professor of Chemistry at New York University, a pioneer in the field of structural DNA nanotechnology, who was not involved in the research. “The algorithm is a major advance.”

Unlike multi-stranded DNA and RNA origami that require in vitro synthesis, the researchers verified in the laboratory that the single-strand folded into user-defined structures in vitro can be replicated en vivo by introducing the DNA sequences into bacteria, including E. coli. Producing molecules in this way would lower costs and chances of mistakes, the research team believes, as nanostructures could be cloned at high volume by replicating bacteria. Polymerase chain reaction amplification&mdasha common technique used to amplify copies of a segment of DNA&mdashwas also demonstrated to reproduce the molecules.

In this first proof-of-concept study, the researchers were able to program protruding DNA loops that acted as handles for adding protein functional groups onto self-assembling large and single-strand DNA origami molecules of up to 10,000 nucleotides. They also created single-strand RNA nanostructures of up to 6,000 nucleotides&mdash10 times the size and complexity of what was previously possible.

Erik Winfree, a professor of computer science, computation, and neural systems, and of bioengineering, at the California Institute of Technology, who was not involved in the work, describes it as “an incredibly elegant design approach for making single-stranded DNA and RNA origami, solving the problem of intrinsic ‘knotting’ of the strands that plagued previous thinking and coming up with a straightforward method for molecular design.”

Yin and his colleagues imagine that future work will include creating single-stranded DNA and RNA nanostructures that could be filled with or attached to enzymes, fluorescent probes, metal particles, or pharmaceuticals, paving the way for a diversity of potential applications, from single-molecule tracking and drug delivery devices to components for nano-electronics.

As Yin says, “Essentially, once you have the ability to precisely control the structure and shape of a nanoscale particle and that particle can be added to other functional elements, there are endless possibilities.”


MATERIALES Y MÉTODOS

Assay for RNA-primed DNA synthesis on a circular, single-stranded DNA template

gp59 was examined for its ability to stimulate the de novo synthesis of DNA on a single-stranded, circular M13 DNA template in the presence of seven core T4 replication proteins and the T4 strand-exchange protein UvsX. In these assays the synthesis of RNA pentameric primers by the gp61 DNA primase (the 61-protein component of the primosome) is completely dependent on the presence of the gp41 DNA helicase (the 41-protein component of the primosome). All reaction mixtures were prepared on ice and contained assay buffer (66 mM potassium acetate, 33 mM Tris acetate, pH 7.8, 10 mM magnesium acetate, and 0.5 mM dithiothreitol), 100 µg/ml (or 50 µg/ml where indicated) HSA, ribo- and deoxyribonucleoside triphosphates (1 mM ATP, 1 mM GTP, and 0.2 mM each of CTP and UTP 0.4 mM each of dATP and dGTP, 0.2 mM dCTP, and 0.2 mM [3H]dTTP at a specific activity of 1560 Ci/mol), M13 DNA template (3.3 µg/ml or 9.8 µM), an ATP regenerating system (10 mM creatine phosphate and 10 µg/ml creatine phosphate kinase, required to compensate for the high level of ATPase activity associated with UvsX protein), and T4 replication proteins (2.5 µg/ml gp43, 30 µg/ml gp44/gp62 protein complex, and 10 µg/ml gp45—constituting the DNA polymerase holoenzyme 1 µg/ml gp61 and 21 µg/ml gp41—constituting the primosome). Present only when indicated were 62 µg/ml gp32, 100 µg/ml UvsX protein, and 0.6 µg/ml gp59. The assays were carried out at 37°C. Aliquots were taken at various times, synthesis was stopped by the addition of Na3EDTA, pH 9.0, to a final concentration of 25 mM on ice, and the [3H]dTTP label incorporated into acid-insoluble DNA products was then determined (Formosa and Alberts, 1986). Results are expressed as nmol of total deoxyribonucleotide incorporated into DNA per ml of assay mixture.

Assay for recombination-dependent DNA synthesis

To examine the ability of gp59 to allow primosome function and Okazaki fragment synthesis (lagging strand synthesis) in a replication system initiated by genetic recombination, reaction mixtures were prepared on ice containing assay buffer (33 mM Tris acetate, pH 7.8, 66 mM potassium acetate, 10 mM magnesium acetate, and 0.5 mM dithiothreitol), 50 µg/ml HSA, ribo- and deoxyribonucleoside triphosphates (2 mM each of ATP and GTP, 0.2 mM each of CTP and UTP, 0.4 mM each of dGTP and dATP, 0.2 mM dCTP, and 0.15 mM [α- 32 P]dTTP [at the specific activity given in the figure legends]), and the ATP regenerating system described previously. To reduce synthesis from nicks present in a minor fraction of template molecules, all reactions contained 2 units/ml T4 DNA ligase as well as 0.25 mM spermine and 0.15 mM spermidine. The following proteins were present in all reactions: 2.5 µg/ml gp43, 30 µg/ml gp44/gp62 protein complex, 10 µg/ml gp45, and 68 µg/ml gp32. The following proteins were present when indicated: 21 µg/ml gp41, 1 µg/ml gp61, 1 µg/ml gp59, 2 µg/ml dda protein, 21 µg/ml UvsX protein, 5 µg/ml UvsY protein, and 2 µg/ml of T4 type II DNA topoisomerase (gp39/gp52/gp60 complex Liu et al., 1979). The T4 UvsY protein nucleates UvsX protein assembly on single-stranded DNA, thus allowing a fivefold lower concentration of UvsX protein to be used (Morrical and Alberts, 1990).

When present, the double-stranded template was 20 µM (nucleotides) of the 7250 base pair M13MP19 DNA (1.38 nM as supercoiled circles or the BglII linearized form as indicated see below). The single-stranded DNA primer was 2 µM (nucleotides) of the 1623 nucleotide, linear fragment (1.23 nM as fragments) cut from M13 single-stranded DNA circles with HaeIII (see below). All components except for the DNA primer, the four deoxyribonucleoside triphosphates, the CTP and UTP, and 75% of the GTP and ATP were preincubated for 4 min at 37°C. Finally, the DNA primer and all of the missing nucleotides were added to start DNA synthesis. Portions of the reaction mixture were subsequently taken at various times and brought to 25 mM Na3EDTA (using a pH 9.0 stock on ice) to stop DNA synthesis. The incorporation of the labeled dTTP into acid-insoluble DNA product is expressed as nmol (nucleotide)/ml reaction. DNA products were also analyzed for size and shape as described below.

DNA product analysis by agarose gel electrophoresis

In all cases, equal volumes of reaction mixture were compared on these gels. The analysis of DNA products by agarose gel electrophoresis under alkaline denaturing conditions (30 mM NaOH) is described in Barry and Alberts (1994). For the analysis of DNA products by neutral gel electrophoresis, samples were first made 0.4% in SDS and heated for 5 min at 65°C to denature DNA binding proteins. Samples were then adjusted to 10% sucrose, 0.03% bromophenol blue, and an additional 20 mM Na3EDTA (pH 8) and loaded onto horizontal 0.8% agarose gels formed in neutral gel running buffer (50 mM Tris-Cl, pH 7.9, 40 mM sodium acetate, and 1 mM Na3EDTA). The gels were run nonsubmerged at 20 V for 40 h, with the running buffer at both anode and cathode changed every 8–10 h. Upon completion, the gels were stained with ethidium bromide and the UV illuminated bands photographed to record the relative positions of standards—including forms I and II of plasmid M13MP19 DNA, the 40 kbp T7 DNA, and the linear double-stranded BstEII and HindIII restriction fragments of bacteriophage lambda DNA. The gels are then acidified, dried, and autoradiographed as in Barry and Alberts (1994).

DNA product analysis by electron microscopy

Recombination-dependent DNA synthesis reactions were carried out as described above with HSA present at 50 µg/ml. Aliquots from reactions stopped with EDTA (see above) were diluted 20-fold to create a solution containing 0.5–1.0 µg/ml DNA, 40% formamide by volume, and 0.1 mg/ml cytochrome C and were spread onto double-distilled water. The resulting cytochrome C–DNA-mixed film was picked up on grids covered with films prepared from 0.5% Formvar (Koller and Delius, 1984). The DNA-containing grids were stained by dipping them for 30 s in a 0.1 mg/ml uranyl acetate solution in 90% ethanol and, after drying, shadowed with platinum. DNA molecules were photographed with a Phillips EM 300 electron microscope using a 50-IA objective aperture and 60 kV accelerating voltage. A reasonably long stretch of a DNA molecule can usually be classified with confidence as either single- or double-stranded, inasmuch as the threadlike double-stranded DNA appears more rigid, smoother, and wider than the single-stranded DNA. However, due to this method's limited resolution, the position where the structure transitions from double- to single-stranded cannot be precisely determined.

DNase I nicking of the DNA products to remove superhelical tension

After 7 min of synthesis, the reaction was stopped with EDTA as described previously. The products of the minus-topoisomerase reaction (reaction 2, in Figure 6) were heated to 65°C for 10 min to denature the T4 replication and recombination proteins, and the DNA was separated from nucleotides and denatured protein on a BioSpin 30 column (BioRad), according to manufacturer's instructions. The DNA was recovered from this column in 40 mM Tris-Cl, pH 7.4, 10 mM MgCl2, 20 µg/ml HSA. Bovine pancreatic DNase I (20 ng/ml) was added for a 5-min incubation at 37°C. The reaction was stopped with excess Na3EDTA and the nicked DNA was prepared for electron microscopy as described above (see Supplemental Figure S4).

Reagents and enzymes

All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed. Nucleoside triphosphates were obtained from Pharmacia, creatine phosphate, creatine phosphate kinase, and DNase I were from Sigma, and human serum albumin (HSA) was from Worthington Biochemical Corporation. Radiolabeled compounds were obtained from Amersham. Other chemicals and biochemicals were obtained from Sigma unless specified otherwise. The T4 DNA topoisomerase was a generous gift from Ken Kreuzer (Duke University). The T4 bacteriophage UvsX and UvsY proteins were purified from overproducing strains as described in Morrical and Alberts (1990). The purified protein products of the cloned T4 genes 44/62 and 45 were prepared according to Morris et al. (1979) and the products of cloned T4 genes 32, 41, 43, 59 and 61 were purified as described in Barry and Alberts (1994).

All protein stocks used were free of contaminating nucleases, as judged by sensitive testing (Bittner et al., 1979). Nuclease testing of UvsX protein and gp32 was done at concentrations that left ∼40% of the single-stranded DNA protein-free (see Figure 1 legend for stoichiometries). Protein concentrations were determined by Bradford assay, using bovine serum albumin (BSA) as the standard. The gp32 concentration was determined by absorption using A280 = 1.07/mg/ml. For the enzyme assays described below, small amounts of each protein were diluted using assay buffer (see below) supplemented with 100 µg/ml human serum albumin (HSA).

Nucleic acids

Circular single-stranded DNA from bacteriophage M13 was isolated as described for bacteriophage fd DNA in Burke et al. (1985). The 1623 nucleotide linear (HaeIII) fragment of M13 single-stranded DNA was prepared and labeled with 32 P at the 5′-end using the alkaline phosphatase/T4 polynucleotide kinase method (Morrical and Alberts, 1990). Supercoiled (form I) DNA from bacteriophage M13MP19 was isolated as described in Morrical and Alberts (1990). M13MP19 DNA was linearized by restriction endonuclease cutting at the unique BglII site.


Ver el vídeo: DNA Technology - In Vivo Gene Cloning (Diciembre 2022).