Información

¿Existe evidencia in vivo de toxicidad por beta amiloide?

¿Existe evidencia in vivo de toxicidad por beta amiloide?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Se cree que la beta amiloide es tóxica, sin embargo, a partir de una breve búsqueda, esto se basa en (1) mediciones in vitro (2) de algunos indicadores de toxicidad (p. Ej., Medición ultrasensible de la entrada de Ca2 + en las vesículas lipídicas inducidas por agregados de proteínas a las que se hace referencia en Wikipedia) .

Mi impresión es que no tenemos ninguna evidencia de alta calidad de que la beta amiloide sea tóxica in vivo y que exista evidencia circunstancial significativa en contra de que sea tóxica (enlaces a continuación). ¿Es esto correcto?

  1. "El 30% de las personas mayores tienen patología de #Alzheimers (placas y / o ovillos) pero ninguna enfermedad"
  2. Hay una anciana con grandes cantidades de placas amiloides pero sin síntomas de Alzheimer
  3. Según Derek Lowe, "todos esos ensayos de anticuerpos amiloides han terminado en graves y costosos fracasos".

A partir de una búsqueda rápida, parece que hay muchas pruebas sólidas de en vivo efectos tóxicos. Un par de papeles aquí y aquí.


Análisis sistemático in vivo de los determinantes intrínsecos de la patogenicidad β amiloide

Afiliaciones Departamento de Química, Universidad de Cambridge, Cambridge, Reino Unido, Departamento de Bioquímica, Universidad de Cambridge, Cambridge, Reino Unido, Departamento de Genética, Universidad de Cambridge, Cambridge, Reino Unido

Afiliación Dipartimento di Scienze Biochimiche, Università degli Studi di Firenze, Firenze, Italia

Departamento de Afiliación de Química, Universidad de Cambridge, Cambridge, Reino Unido

Afiliaciones Departamento de Medicina, Universidad de Cambridge, Cambridge, Reino Unido, Instituto de Investigación Médica de Cambridge, Cambridge, Reino Unido

Departamento de Afiliación de Química, Universidad de Cambridge, Cambridge, Reino Unido

* A quién debe dirigirse la correspondencia. Correo electrónico: [email protected]

Afiliaciones Departamento de Genética, Universidad de Cambridge, Cambridge, Reino Unido, Departamento de Medicina, Universidad de Cambridge, Cambridge, Reino Unido


Introducción

La enfermedad de Alzheimer se caracteriza por el depósito en el cerebro de placas seniles, compuestas principalmente por el péptido β-amiloide (Aβ). La hipótesis de la cascada de amiloide postula que en la enfermedad de Alzheimer, la acumulación de Aβ en el cerebro conduce finalmente a cambios en el metabolismo de tau, lo que conduce a la deposición de tau en los ovillos neurofibrilares (NFT) que son la causa proximal probable de la pérdida neuronal observada en este enfermedad [25]. Si bien todavía existe una controversia significativa sobre si la hipótesis de la cascada de amiloide explica la patología de Alzheimer [28, 39, 72], existe una amplia evidencia (in vitro e in vivo) de que la exposición de las neuronas a Aβ puede conducir a la hiperfosforilación de tau, un posible impulsor de la deposición de tau [23, 51, 87]. Se han identificado múltiples tau quinasas (revisadas en [57]), al igual que vías por las cuales estas quinasas podrían activarse para aumentar la fosforilación de tau [15, 55, 89]. CDK5 y GSK3β han surgido como fuertes candidatos para tau quinasas relevantes para la enfermedad [27, 50], y la activación de ambas quinasas puede ocurrir después de la activación de la calpaína. Las calpaínas son proteasas dependientes del calcio que pueden escindir P35 para producir P25, un potente activador de CDK5 [81] o truncar directamente GSK3β, lo que lleva a su activación [34]. Muchos estudios también han demostrado que la exposición de neuronas a Aβ puede conducir a la entrada de calcio [30, 77, 78] y, por lo tanto, existe un mecanismo molecular bien respaldado que explica cómo la exposición a Aβ puede conducir a la hiperfosforilación de tau. Menos claro es el fundamento biológico de la fosforilación de tau inducida por Aβ. ¿Es esta una función seleccionada de Aβ, una consecuencia indirecta de una interacción evolucionada de Aβ con las células, o una interacción esencialmente aleatoria con resultados potencialmente perjudiciales?

Abordar "por qué" Aβ induce la fosforilación de tau se complica por la incertidumbre en cuanto a qué función seleccionada, si es que tiene alguna, tiene el péptido Aβ. De manera similar, queda sin resolver cómo el Aβ extracelular induce aumentos intracelulares de calcio. La toxicidad de Aβ en numerosos modelos puede atenuarse bloqueando el receptor de glutamato de tipo NMDA [5, 11, 24], lo que sugiere que este canal de calcio podría ser responsable de la afluencia de calcio dependiente de Aβ. De manera similar, se ha afirmado que la proteína prión es un receptor de oligómeros Aβ [7, 44, 74] y un influjo moderado de calcio dependiente de Aβ [67]. Otros estudios han implicado a los receptores de glutamato AMPA [2, 73, 88] o los canales de calcio activados por voltaje de tipo L [4] en los aumentos de calcio citoplásmico que resultan de la exposición a Aβ. Mientras que múltiples canales de calcio podrían estar involucrados en el influjo de calcio dependiente de Aβ, otros estudios sugieren que los oligómeros de Aβ podrían actuar independientemente de los canales de calcio endógenos formando directamente un poro permeable al calcio. Se sabe desde hace mucho tiempo que el Aβ sintético puede formar canales permeables a los iones en las membranas sintéticas [6], un hallazgo que a menudo se ha replicado [29, 41, 71]. Aunque las estructuras anulares de los oligómeros Aβ se han visualizado mediante microscopía de fuerza atómica en membranas sintéticas [46], los poros de la membrana Aβ en células patológicamente relevantes no se han visualizado ni analizado directamente.

Un enfoque para determinar si los poros de Aβ son relevantes para la neurotoxicidad de Aβ es identificar sustituciones en la secuencia de Aβ que bloquean la formación de poros en membranas sintéticas y luego determinar si estas sustituciones alteran la toxicidad de Aβ. Kim y col. [41] observaron un motivo de secuencia (Gly-XXX-Gly-XXX-Gly) presente tanto en el extremo C de Aβ como en los dominios transmembrana de las proteínas del canal bacteriano, y propusieron que este motivo (la "cremallera de glicina") podría facilitar Interacciones α-helicoidales que impulsan el ensamblaje del oligómero Aβ en las membranas y la posterior formación de poros. Estos investigadores demostraron que las sustituciones de leucina en estos residuos de glicina (en particular, Gly 37 Leu) impidieron que el Aβ 1-42 sintético formara canales iónicos en las membranas sintéticas y también redujeron significativamente la toxicidad del Aβ en las células Neuro 2A. Fonte y col. [20] amplió estos resultados y demostró que la sustitución de Gly 37 Leu redujo la toxicidad de Aβ en un transgénico in vivo C. elegans modelo que expresa Aβ humano y evita que los oligómeros de Aβ sintéticos induzcan la hiperfosforilación de tau en las neuronas del hipocampo. Peters y col. [68] posteriormente demostró que un pentapéptido derivado de la secuencia de cremallera de glicina (GLMVG) inhibía la sinaptotoxicidad de Aβ. Estas observaciones son consistentes con la formación de poros subyacente a la neurotoxicidad de Aβ, pero no demuestran directamente la formación de poros y no pueden excluir otras interpretaciones, como la posibilidad de que las sustituciones de cremalleras de glicina interfieran con interacciones con receptores específicos de la superficie celular.

Un enfoque alternativo para inferir la formación de poros por Aβ es buscar su capacidad para inducir una respuesta biológica conocida a poros inducidos exógenamente, en lugar de intentar obtener imágenes de los poros mismos. Andrews et al. Han definido una vía de reparación de la membrana que se produce en respuesta a la exposición a la estreptolisina O, (SLO), una toxina bacteriana formadora de poros bien caracterizada [32]. Como se describe en la Fig.1, esta vía de reparación de varios pasos implica: 1) la entrada de calcio a través del poro SLO, 2) la fusión de los lisosomas locales con la membrana plasmática, liberando el contenido lisosómico, 3) la escisión de los esfingolípidos cercanos en la valva externa de la membrana plasmática mediante esfingomielinasa ácida derivada de lisosomas, lo que induce una curvatura localizada hacia el interior de la membrana, y 4) la eliminación de la membrana plasmática que contiene los poros mediante endocitosis. Si bien aparentemente se emplean diferentes mecanismos de reparación de membrana para diferentes clases de toxinas formadoras de poros [19], si el influjo de calcio inducido por Aβ es el resultado de un poro análogo al SLO, se pueden hacer tres predicciones sólidas: 1) La exposición a Aβ inducirá esfingomielinasa dependiente endocitosis, 2) variantes de Aβ no tóxicas (p. ej., Aβ42 Gly 37 Leu) será incapaz de inducir la reparación de la membrana porque no pueden oligomerizar adecuadamente para formar poros de membrana, y 3) la exposición a toxinas formadoras de poros imitará los efectos de los oligómeros Aβ, específicamente la hiperfosforilación de tau. Aquí probamos estas predicciones usando una novela C. elegans modelo y cultivos primarios de neuronas del hipocampo de rata.

Modelo de reparación de membranas. Este modelo se basa en el mecanismo de reparación de los poros de la membrana plasmática (PM) creados en células de mamíferos por exposición a la toxina bacteriana formadora de poros SLO [32]. ASM es espingomielinasa ácida que se almacena en lisosomas, que se fusionan con la PM en respuesta a un influjo de Ca2 + a través del poro creado por SLO (Paso 1), liberando ASM en la superficie celular (Paso 2). La liberación localizada de ASM escinde el grupo de cabeza de fosforilo de esfingomielinasa en la vecindad del poro para generar ceramida en esa área (Paso 3). En consecuencia, el MP alrededor del poro sufre una curvatura hacia adentro y endocitosis de tal manera que el poro se elimina del MP (Paso 4)

Transgénico C. elegans Se han construido cepas que expresan Aβ humana.42 [16, 17, 18, 47, 82], y estas cepas tienen una variedad de fenotipos, dependiendo de dónde se exprese el transgén. Un factor de confusión de estos modelos es que el Aβ detectable es intracelular cuando se analiza mediante inmunohistoquímica, por lo que no está claro el grado de toxicidad de Aβ de afuera hacia adentro (es decir, Aβ extracelular que afecta a las células vecinas). Para sortear esta limitación, hemos desarrollado un modelo de "alimentación", donde C. elegans se alimenta E. coli diseñado para secretar Aβ humano, y los efectos celulares de este péptido exógeno se ensayan en células intestinales. Un fundamento de este modelo es que el C. elegans intestino no expresa receptores Aβ candidatos (por ejemplo, proteína priónica, receptores de glutamato NMDA, α7nAChR, etc.) y, por lo tanto, es poco probable que cualquier respuesta fisiológica a Aβ esté mediada por receptores. La transparencia de C. elegans y la existencia de cepas informadoras transgénicas relevantes permite seguir los efectos de la exposición a Aβ en animales vivos intactos. Usando este modelo, mostramos que la exposición a Aβ de tipo salvaje42 (pero no Aβ42 Gly 37 Leu) induce endocitosis dependiente de esfingomielinasa ácida que es paralela a la respuesta a una toxina formadora de poros conocida, CRY5B. Encontramos que esta respuesta a Aβ depende de la calpaína y se ve alterada por mutaciones de pérdida de función en el C. elegans ortólogos de BIN1 y PICALM, dos genes de riesgo de Alzheimer identificados en estudios de asociación de todo el genoma [61, 84]. En cultivos de hipocampo, mostramos que la toxina formadora de poros SLO induce la fosforilación de tau dependiente de calpaína en neuronas primarias. Además, la esfingomielinasa exógena por sí misma puede inducir un aumento de la fosforilación de tau en estas neuronas. Finalmente, utilizamos un método de etiquetado novedoso para demostrar que la sustitución de Gly 37 Leu inhibe la multimerización de Aβ en un contexto celular, racionalizando así por qué esta variante de Aβ es incapaz de inducir la reparación de la membrana o la fosforilación de tau. Tomados en conjunto, estos resultados apoyan la opinión de que la hiperfosforilación de tau puede ser una consecuencia posterior de un proceso de reparación de la membrana, y que el Aβ exógeno puede inducir la reparación de la membrana debido a su capacidad para oligomerizar en los poros de la membrana.


Abstracto

Existe una evidencia creciente de que una clase de glicolípidos de la membrana celular, los gangliósidos, pueden mediar la fibrilogénesis y la toxicidad del péptido amiloide-β (Aβ) de la enfermedad de Alzheimer. Usando monocapas de lípidos y vesículas como membranas modelo, medimos la inserción de Aβ en 1,2-dipalmitoyl-sn-glicero-3-fosfocolina (DPPC) -gangliósido GM1 monocapas para sondear Aβ − GM1 interacciones, obtuvieron imágenes de los efectos de la inserción de Aβ en la morfología de la monocapa y midieron la tasa de formación de fibrillas de Aβ cuando se incubaron con 1-palmitoil-2-oleoil-sn-glicero-3-fosfocolina (POPC) -GM1 vesículas. Además, la ubicación de la asociación Aβ en la monocapa se evaluó mediante experimentos de fluorescencia de sonda dual. Aβ exhibió interacciones directas y favorables con GM1 como la inserción de Aβ aumentó monótonamente con GM1 concentración, a pesar de los aumentos en la rigidez de la monocapa a baja GM1 niveles. A baja GM1 concentraciones, Aβ se inserta preferentemente en la fase líquida expandida desordenada. A mayor GM1 concentraciones, Aβ se inserta de manera más uniforme en la monocapa, lo que resulta en preferencias no detectables para la fase desordenada o condensada. La inserción de Aβ condujo a la alteración de la morfología de la membrana, específicamente a la expansión de la fase desordenada a baja GM1 concentraciones y una alteración significativa de los dominios condensados ​​a mayor GM1 concentraciones. Durante la incubación con vesículas de POPC que contienen niveles fisiológicos de GM1, la asociación de Aβ con vesículas sembró la formación de fibrillas de Aβ. En conclusión, interacciones favorables entre Aβ y GM1 en la membrana celular puede proporcionar un mecanismo para la fibrilogénesis Aβ en vivo, y la rotura de la membrana celular inducida por Aβ puede proporcionar una vía por la cual Aβ ejerce toxicidad.

Este trabajo fue apoyado por la Alzheimer's Association (IIRG-9901175) y la American Health Assistance Foundation (A1999057). El aparato experimental fue posible gracias a una Subvención para Docentes Juveniles del Programa de Instrumentación e Instalaciones de Investigación Química de la Fundación Nacional de Ciencias (CHE-9816513). E.Y.C. recibió el apoyo de la Beca Individual del Premio al Servicio de Investigación Nacional Ruth L. Kirschstein de los Institutos Nacionales de Salud (AG025649). S.L.F. agradece el apoyo de una beca de investigación para graduados de la National Science Foundation.

A quién deben dirigirse las correspondencias. Teléfono: (773) 702-7068. Fax: (773) 702-0805. Correo electrónico: [email & # 160protected]


Multimerización, nucleación y deposición

El ensamblaje de A & # x003b2 en estructuras multiméricas es clave para el efecto biológico de esas especies. Hay dos fases de ensamblaje que tienen diferentes características y conducen a ensamblajes con diferentes propiedades biológicas. El trabajo inicial con A & # x003b2 se centró en las características histológicas de la EA, los depósitos amorfos y fibrilares del péptido. El enfoque actual está en la fase anterior del ensamblaje de A & # x003b2 que involucra multímeros solubles del péptido. Estas estructuras son órdenes de magnitud más tóxicas para las células de diferentes tipos que las fibrillas y desencadenan un conjunto diferente de eventos tóxicos [90]. También son morfológica y conformacionalmente distintos. Los anticuerpos conformacionales específicos de oligómeros no reconocen monómeros o fibrillas, y los anticuerpos específicos de fibrillas no reconocen oligómeros solubles. Si bien el abandono total de la participación de las fibrillas en la EA en este momento es probablemente prematuro dada la historia del PIB discutida anteriormente y el potencial de participación de la placa con las poblaciones de oligómeros [91], el foco del campo A & # x003b2 se ha desplazado hacia los oligómeros solubles.

Los oligómeros se forman fácilmente a partir del péptido A & # x003b2 (1-42), y menos a partir del A & # x003b2 (1-40) [92], que es más abundante. Existe una estrecha correlación entre la proporción de 42/40 y la edad de inicio de la enfermedad en la EA familiar [93]. El extremo C-terminal de A & # x003b2 (1-42) es crítico para la formación de oligómeros. Bitan et al. [94] definió algunos de los parámetros estructurales para los diferentes pasos de in vitro ensamblaje de oligómeros con péptidos sintéticos mutados en esa región. Mientras que los primeros intermedios durante la oligomerización de péptidos sintéticos son inestables y requieren el atrapamiento fotoquímico de los intermedios, se pueden aislar pequeños oligómeros estables de sistemas biológicos. Se desconoce la explicación de esta diferencia de estabilidad. Se ha demostrado que los oligómeros A & # x003b2 con subestructuras estables a SDS tan pequeñas como dímeros aislados del cerebro con EA y del LCR alteran la electrofisiología sináptica [95, 96]. Si estos intermedios surgen durante el montaje o después del desmontaje en vivo, queda por determinar. Los oligómeros sintéticos solubles A & # x003b2 son altamente polimórficos con tamaños estables que dependen del método de preparación [97]. Si bien los investigadores están de acuerdo en que los oligómeros solubles son biológicamente activos y pueden causar la muerte celular en algunas condiciones, el modo de acción de los oligómeros solubles también queda por determinar. Se observan efectos mediados por receptores [98, 99], así como la actividad directa de los oligómeros en la bicapa de la membrana, especialmente a concentraciones altas (& # x003bcM) que pueden derivarse de su actividad superficial. La concentración de oligómeros solubles en el LCR o en el líquido intersticial del cerebro se encuentra en el intervalo de pM [100].

La formación de fibrillas se estudia a altas concentraciones micromolares de péptido sintético monomérico para aumentar la probabilidad de que se forme un núcleo de fibrillas. Existe evidencia [101] de que la formación de oligómeros solubles y la formación de fibrillas pueden ser vías diferentes, aunque mecánicamente ambos procesos tienen que pasar por etapas multiméricas. Dado que las concentraciones de A & # x003b2 en el líquido intersticial cerebral son al menos tres órdenes de magnitud más bajas que en los ensayos de formación de fibrillas, es probable que la formación de fibrillas esté nucleada en la matriz extracelular o en las superficies celulares. El crecimiento de fibrillas por extensión en fibrillas preexistentes de cerebro tanto sintéticas como con EA depende linealmente de la concentración de monómero A & # x003b2 [102] y es muy específico para la forma de fibrillas amiloides [103]. El proceso es reversible en vivo en modelos de ratones transgénicos controlados por microscopía multifotónica [104] y es sorprendentemente rápido en ese sistema e incluye amiloide vascular [105]. Aunque este proceso no se ha documentado en el cerebro humano vivo, los efectos de la administración de anticuerpos activos y pasivos en modelos animales [106] y ensayos de inmunización humana [2] sugieren que los depósitos de A & # x003b2 en el cerebro estarán en equilibrio con el intersticial. A & # x003b2. También hay pruebas consistentes con depósitos insolubles de A & # x003b2 que sirven como depósito de oligómeros solubles [91]. No todos los grupos de A & # x003b2 en el cerebro humano pueden participar en este intercambio rápido de monómero y se desconoce la participación relativa de los diferentes grupos en el proceso patológico.


Métodos

Participantes

El presente estudio fue parte del Estudio Coreano sobre el Envejecimiento del Cerebro para el Diagnóstico Temprano y la Predicción de la Enfermedad de Alzheimer (KBASE), un estudio de cohorte prospectivo en curso que comenzó en 2014. El estudio KBASE tuvo como objetivo buscar nuevos biomarcadores de EA e investigar cómo las experiencias de vida multifacéticas y Los cambios corporales contribuyen a los cambios cerebrales relacionados con la EA. El estudio actual analizó los datos de 414 individuos sin demencia (280 individuos cognitivamente normales [CN] y 134 individuos con deterioro cognitivo leve [DCL]) entre 56 y 90 años de edad (edad media 70,9 ± desviación estándar 7,8 hombres, norte [%] = 180 [43,5]) que fueron reclutados al 30 de noviembre de 2016. Los participantes fueron reclutados a través de 4 sitios de reclutamiento en Seúl, Corea del Sur. Se informó a las personas potencialmente elegibles que participaron en un programa de detección de demencia en 2 centros públicos para la prevención y el manejo de la demencia o que visitaron clínicas de memoria en 2 hospitales universitarios (es decir, el Hospital de la Universidad Nacional de Seúl y el Centro Médico SNU-SMG Boramae) en Seúl, Corea del Sur sobre la participación en el estudio, y aquellos que se ofrecieron como voluntarios fueron invitados a una evaluación de elegibilidad. Además, se reclutaron voluntarios de la comunidad a través de anuncios en línea, carteles y folletos en los principales sitios de reclutamiento y el boca a boca (recomendado por otros participantes, familiares, amigos o conocidos). Se ha publicado previamente información más detallada sobre las características del estudio KBASE, incluido el reclutamiento [35]. El grupo CN estaba formado por participantes con una calificación de Demencia Clínica (CDR) [36] de 0 y sin diagnóstico de DCL o demencia. Todos los individuos con DCL cumplieron con los criterios de consenso actuales para DCL amnésico, que son los siguientes: (1) quejas de memoria confirmadas por un informante, (2) deterioro de la memoria objetiva, (3) función cognitiva global preservada, (4) independencia en las actividades funcionales y (5) sin demencia. Con respecto al criterio 2, la edad, educación y sexo ajustada z-puntuaciones para al menos 1 de 4 pruebas de memoria episódica fue & lt − 1.0. Las 4 pruebas de memoria fueron: Memoria de lista de palabras, Recuperación de lista de palabras, Reconocimiento de lista de palabras y Recuperación constructiva, que se incluyen en la versión coreana de la batería de evaluación neuropsicológica Consortium to Establish a Registry for Alzheimer's Disease (CERAD-K) [37 ]. Todos los individuos con DCL tenían una puntuación de CDR de 0,5.

Los criterios de exclusión fueron los siguientes: (1) presencia de una enfermedad psiquiátrica importante, incluidos trastornos relacionados con el alcohol (2) afecciones neurológicas o médicas significativas o comorbilidades que podrían afectar la función mental (3) contraindicaciones para una resonancia magnética (p. Ej., Marcapasos o claustrofobia) (4) analfabetismo (5) la presencia de dificultades visuales / auditivas significativas y / o problemas graves de comunicación o comportamiento que dificultarían los exámenes clínicos o escáneres cerebrales (6) tomar un medicamento en investigación y (7) estar embarazada o amamantando.

El protocolo del estudio fue aprobado por las juntas de revisión institucional del Hospital de la Universidad Nacional de Seúl (C-1401-027-547) y el Centro Médico SNU-SMG Boramae (26-2015-60), Seúl, Corea del Sur, y el estudio se realizó en de acuerdo con las recomendaciones de la versión actual de la Declaración de Helsinki. Los participantes o sus representantes legales dieron su consentimiento informado por escrito.

Evaluaciones clínicas

Todos los participantes se sometieron a evaluaciones clínicas y neuropsicológicas integrales administradas por psiquiatras y neuropsicólogos capacitados según el protocolo de evaluación KBASE [35], que incorpora la batería de evaluación neuropsicológica CERAD-K [38,39].

Evaluación de la ingesta de alcohol

Todos los participantes fueron entrevistados sistemáticamente por enfermeras capacitadas para determinar el consumo de alcohol mediante un formulario de entrevista (Formulario de entrevista S1) en el edificio de ciencias médicas en el campus médico de la Universidad Nacional de Seúl, Seúl, Corea del Sur. Según la directriz de la Organización Mundial de la Salud [40], 1 bebida estándar (SD) se definió como cualquier bebida que contuviera 10 gramos de alcohol puro. Debido a que existe una amplia variedad de bebidas y marcas alcohólicas, las diferentes bebidas se clasificaron de la siguiente manera: 1 lata de cerveza (4,5% de alcohol 330 ml) = 1 SD 1 botella de cerveza (4,5% de alcohol 640 ml) = 2 SD, 1 botella de licor local coreano (20% de alcohol 360 ml) = 6 SD, 1 botella de licor (40% de alcohol 750 ml) = 24 SD, 1 botella de vino tradicional coreano (8% de alcohol 900 ml) = 6 SD y 1 botella de vino (12% de alcohol 900 ml) = 9 DE. Además, los patrones de ingesta de alcohol de cada participante se clasificaron de la siguiente manera: estado de consumo (no bebedor, ex bebedor, bebedor) y frecuencia y cantidad de ingesta de alcohol (DE / día de consumo, días de consumo / semana, DE / semana) durante el año pasado (actual) y toda la vida. Entre los bebedores, los que bebieron más de 6 SD por día durante el último año se subclasificaron como bebedores compulsivos [10]. Entre los no bebedores actuales, los que solían beber regularmente pero no habían bebido alcohol en el último año se subclasificaron como ex bebedores [5,11]. Estudios epidemiológicos previos sobre el efecto de la ingesta de alcohol mostraron que había una clara diferencia en el riesgo de demencia general o de EA entre los grupos que no bebían (referencia), que bebían anteriormente, bebían levemente, bebían moderadamente y bebían mucho [11,22,41 ]. Según estos informes, nuestros participantes se clasificaron según la ingesta semanal de alcohol de la siguiente manera: sin beber (categoría de referencia), antes de beber, & lt1 SD / semana (& lt10 gramos / semana de consumo moderado), 1-13 SD / semana (10-130 gramos / semana de consumo moderado) y más de 14 DE / semana (≥140 gramos / semana de consumo inseguro en las directrices recientemente revisadas del Departamento de Salud del Reino Unido [42]).

Evaluación de posibles factores de confusión

La ingesta de alcohol puede verse influida por otras afecciones. Por lo tanto, todos los participantes fueron evaluados sistemáticamente sobre posibles factores de confusión, como depresión, riesgo vascular, peso corporal, índice de masa corporal (IMC), complejidad ocupacional, ingresos anuales y genotipificación de la apolipoproteína E (APOE). La Escala de Depresión Geriátrica (GDS) [43] se utilizó para evaluar la depresión. El peso corporal, la altura y las tasas de comorbilidad de los factores de riesgo vascular (incluida la hipertensión, la diabetes mellitus, la dislipidemia, la enfermedad coronaria, el ataque isquémico transitorio y el accidente cerebrovascular) se evaluaron con base en los datos recopilados por enfermeras capacitadas durante las entrevistas sistemáticas de los participantes y sus informantes. se calculó como el peso en kilogramos dividido por el cuadrado de la altura en metros, y se calculó una puntuación de riesgo vascular basada en el número de factores de riesgo vascular [44]. Con respecto a la complejidad ocupacional, solo se consideró la ocupación de mayor antigüedad, clasificada en 4 niveles según los niveles de habilidad descritos en la Clasificación Internacional Uniforme de Ocupaciones [45]. Las ocupaciones en el nivel de habilidad 1 generalmente involucran tareas físicas o manuales simples y rutinarias. Las ocupaciones en el nivel de habilidad 2 incluyen el desempeño de tareas tales como operar maquinaria y equipo electrónico, conducir vehículos, mantenimiento y reparación de equipo eléctrico y mecánico, y manipulación, pedido y almacenamiento de información. Las ocupaciones en el nivel de habilidad 3 incluyen el desempeño de tareas técnicas y prácticas complejas que requieren resolución de problemas complejos, razonamiento y toma de decisiones en un campo especializado. Las ocupaciones en el nivel de habilidad 4 implican el desempeño de tareas que requieren resolución de problemas complejos, toma de decisiones y creatividad basadas en un extenso cuerpo de conocimientos teóricos y fácticos en un campo especializado. La información sobre la ocupación fue obtenida de autoinformes de los participantes y confirmada por informantes confiables. Los ingresos anuales se evaluaron y categorizaron en 3 grupos (por debajo del costo de vida mínimo [MCL], igual o superior al MCL pero por debajo del doble del MCL, el doble del MCL o más http://www.law.go.kr). El MCL se determinó de acuerdo con la regla administrativa publicada por el Ministerio de Salud y Bienestar de la República de Corea en noviembre de 2012. El MCL fue de 572,168 won coreanos (KRW) (equivalente a US $ 507,9) para un hogar de una sola persona y se agregó 286,840 KRW (equivalente a US $ 254,6) por cada miembro adicional del hogar. Se obtuvieron muestras de sangre mediante venopunción, se extrajo ADN genómico de sangre completa y se realizó el genotipado APOE como se describió anteriormente [46]. La positividad de apolipoproteína ε4 (APOE4) se codificó si estaba presente al menos 1 alelo ε4.

Medición de la deposición cerebral de Aβ

Todos los participantes se sometieron a exploraciones simultáneas de 3D PiB PET y 3D T1 ponderadas por resonancia magnética utilizando un escáner 3.0T Biograph mMR (PET-MR) (Siemens) de acuerdo con las pautas del fabricante.Los detalles de la adquisición de imágenes PiB PET y el preprocesamiento se proporcionan en el Método S1. Se aplicaron el algoritmo de etiquetado anatómico automático y un método de combinación de regiones [47] para determinar las regiones de interés (ROI), para caracterizar los niveles de retención de PiB en las regiones frontal, parietal lateral, cingulado / precuneus posterior y lateral temporal. Los valores de la relación de valor de captación estandarizada (SUVR) para cada ROI se calcularon dividiendo el valor medio de todos los vóxeles dentro de cada ROI por el valor de captación cerebelosa media en la misma imagen. También se definió una ROI cortical global que consta de 4 ROI, y se generó un valor de retención de Aβ global dividiendo el valor medio de todos los vóxeles de la ROI cortical global por el valor de captación cerebelosa media en la misma imagen [47,48]. Los participantes se clasificaron como Aβ + si la retención global de Aβ era & gt1.21, y como Aβ− si la retención global de Aβ era ≤1.21 [49].

Medición de la neurodegeneración característica de la EA

Todos los participantes se sometieron a imágenes de PET con FDG utilizando el escáner PET-MR mencionado anteriormente. Los detalles de la adquisición y el preprocesamiento de imágenes de PET con FDG se proporcionan en el Método S1. Se determinaron las ROI de FDG de firma AD, como las circunvoluciones angulares, la corteza cingulada posterior y las circunvoluciones temporales inferiores, que son sensibles a los cambios asociados con la EA [50]. El metabolismo cerebral de la glucosa de la firma AD (AD-CM) se definió como el SUVR medio ponderado por vóxeles extraído de las ROI de FDG de firma AD; los detalles de la adquisición y el preprocesamiento de la resonancia magnética se proporcionan en el Método S1. El grosor cortical de la firma AD (AD-CT) se definió como los valores de espesor cortical medio obtenidos de las regiones de la firma AD, incluidas las regiones entorrinal, temporal inferior, temporal media y circunvolución fusiforme, como se describió anteriormente [50].

Medición de WMH

Todos los participantes se sometieron a resonancias magnéticas con recuperación de inversión atenuada por líquido (FLAIR) utilizando el escáner PET-MR 3.0T mencionado anteriormente. Los detalles de las mediciones de volumen de las WMH cerebrales se proporcionan en el Método S1.

Análisis estadístico

Para probar las asociaciones hipotéticas entre la ingesta moderada de alcohol y los biomarcadores de neuroimagen y para explorar la asociación entre otras categorías de ingesta de alcohol y los biomarcadores, planeamos realizar análisis de regresión múltiple de la siguiente manera. Primero, análisis de regresión logística múltiple con la categoría de ingesta de alcohol a lo largo de la vida (o actual) (es decir, no beber, & lt1 DE / semana, 1-13 DE / semana y 14+ DE / semana) como variable independiente y la positividad de Aβ como variable dependiente variable se llevaron a cabo. En estos análisis, para comparar el efecto de la ingesta de alcohol en relación con no beber, no se utilizó como referencia (es decir, no beber versus & lt1 DE / semana, no beber versus 1-13 DE / semana, o no beber versus 14+ SD / semana) dentro de cada modelo. Se probaron tres modelos, con control gradual de los posibles factores de confusión que podrían afectar la asociación entre la ingesta de alcohol y los biomarcadores de EA. El primer modelo (Modelo 1) no incluyó ninguna covariable, el segundo modelo (Modelo 2) incluyó edad, sexo, APOE4, puntaje de riesgo vascular y puntaje GDS como covariables y el tercer modelo (Modelo 3) incluyó las covariables en el segundo modelo más educación (educación secundaria o inferior frente a más que educación secundaria), diagnóstico clínico (CN frente a DCL), complejidad ocupacional, ingresos anuales, peso corporal e IMC [51]. En segundo lugar, se realizaron análisis de regresión lineal múltiple para comparar las diferencias en la retención global de Aβ, AD-CM, AD-CT y WMH entre los grupos de consumo de alcohol de por vida (o actual) mientras se controlaban las mismas covariables. En los análisis, se utilizó la retención global de Aβ después de la transformación logarítmica natural para lograr una distribución normal.

Como análisis de sensibilidad, también realizamos los mismos análisis después de excluir a los bebedores compulsivos de los bebedores actuales o de toda la vida para reducir la influencia del patrón de consumo excesivo de alcohol en la asociación entre la frecuencia y la cantidad de ingesta de alcohol y las variables de neuroimagen. Además, hicimos los mismos análisis después de excluir a los ex bebedores de los no bebedores actuales para minimizar los efectos potenciales de los abstemios forzosos que dejaron de consumir alcohol debido a otros problemas de salud relacionados con problemas con la bebida.

Para investigar la influencia de la edad (menor [& lt75 años] versus mayor [≥75 años]) [52], sexo (mujer versus hombre), APOE4 (APOE4 + versus APOE4−) y diagnóstico clínico (NC versus DCL)] on the association between alcohol intake and neuroimaging biomarkers that were significant in the analyses described above, the same regression analysis was repeated including a 2-way interaction term between alcohol intake and each of the 4 neuroimaging biomarkers as an additional independent variable.

All statistical analyses were performed using IBM SPSS Statistics 24.


Introducción

Genetic, biochemical, and animal model studies strongly suggest a central role for amyloid-β (Αβ) in the pathogenesis of Alzheimer's disease (AD) (Sisodia, 1999 Golde et al., 2000 St. George-Hyslop, 2000 Selkoe, 2001). Aβ is a 38-43 amino acid peptide derived from the amyloid precursor protein (APP). Early-onset forms of familial, autosomal dominant AD appear to be attributable to an overproduction of a more amyloidogenic form of Aβ (Aβ42), resulting in conversion of Aβ, in early adult life, from soluble, nontoxic forms to both soluble and insoluble toxic forms with a high β-sheet content (Tanzi et al., 1996). In contrast, the most common form of AD (late-onset, age >60) does not appear to result from Aβ overproduction. Instead, other genetic [e.g., APOE (apolipoprotein E) allelic differences] and nongenetic factors appear to be important in determining whether and when Aβ conformational changes occur (Wisniewski et al., 1997 Teplow, 1998 Holtzman, 2001). Thus, understanding not only mechanisms of Aβ production but also factors that control Aβ metabolism are likely to be critical for understanding AD pathogenesis, as well as for developing better diagnostic and treatment methods.

A major pathologic hallmark of AD is the deposition of the normally soluble Aβ peptide into aggregated, extracellular structures called plaques (Price et al., 1998 Selkoe, 2001). Although it is not proven whether the seed, or nidus, of plaques originates extracellularly or intracellularly, recent evidence suggests that initial formation and growth of plaques can occur extracellularly (Meyer-Luehmann et al., 2003). Regardless of where plaques originate, it is likely that the subsequent Aβ building blocks for plaques are derived from the brain interstitial fluid (ISF). Aβ appears to be released from neurons into the extracellular space normally via synaptic activity (Kamenetz et al., 2003). Assessment of the ISF pool of Aβ may provide unique insights into the regulation of Aβ metabolism, Aβ aggregation, and plaque formation. To date, however, there have been no methods that have permitted analysis of ISF Aβ.

To this end, we developed an en vivo microdialysis technique to measure ISF Aβ in awake, APP transgenic mice that develop age-dependent Aβ aggregation and deposition (PDAPP mice) (Games et al., 1995). We compared the steady-state concentrations of several Aβ species in the ISF of 3-month-old and 12- to 15-month-old PDAPP mice to those species within the CSF and tissue. These studies show that the development of Aβ deposition is associated with changes in ISF Aβ levels and ratios that differ in relation to tissue lysates and CSF. By combining our microdialysis technique with a potent γ-secretase inhibitor, we also demonstrate that the half-life of ISF Aβ is short and is markedly influenced by the presence of Aβ deposition. This strongly suggests that rapid inhibition of Aβ production en vivo reveals an equilibrium between soluble and part of the insoluble pool of Aβ. This rapidly dissociable, now measurable pool of Aβ may provide new ways to diagnose the presence of Aβ deposits and is likely to be the target of various anti-Aβ treatments.


Referencias

Arriagada PV, Growdon JH, Hedley-Whyte ET, Hyman BT (1992) Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer’s disease. Neurology 42:631–639

Bolmont T, Clavaguera F, Meyer-Luehmann M, Herzig MC, Radde R, Staufenbiel M, Lewis J, Hutton M, Tolnay M, Jucker M (2007) Induction of tau pathology by intracerebral infusion of amyloid-beta -containing brain extract and by amyloid-beta deposition in APP x Tau transgenic mice. Am J Pathol 171:2012–2020

Braak H, Thal DR, Ghebremedhin E, Del Tredici K (2011) Stages of the pathologic process in Alzheimer disease: age categories from 1 to 100 years. J Neuropathol Exp Neurol 70:960–969

Brendza RP, Bacskai BJ, Cirrito JR, Simmons KA, Skoch JM, Klunk WE, Mathis CA, Bales KR, Paul SM, Hyman BT, Holtzman DM (2005) Anti-Abeta antibody treatment promotes the rapid recovery of amyloid-associated neuritic dystrophy in PDAPP transgenic mice. J Clin Invest 115:428–433

Chetelat G (2013) Alzheimer disease: Abeta-independent processes-rethinking preclinical AD. Nat Rev Neurol 9:123–124

de Calignon A, Polydoro M, Suarez-Calvet M, William C, Adamowicz DH, Kopeikina KJ, Pitstick R, Sahara N, Ashe KH, Carlson GA, Spires-Jones TL, Hyman BT (2012) Propagation of tau pathology in a model of early Alzheimer’s disease. Neuron 73:685–697

Geneser-Jensen FA, Blackstad TW (1971) Distribution of acetyl cholinesterase in the hippocampal region of the guinea pig. I. Entorhinal area, parasubiculum, and presubiculum. Z Zellforsch Mikrosk Anat 114:460–481

Gotz J, Chen F, van Dorpe J, Nitsch RM (2001) Formation of neurofibrillary tangles in P301l tau transgenic mice induced by Abeta 42 fibrils. Science 293:1491–1495

Hardy JA, Higgins GA (1992) Alzheimer’s disease: the amyloid cascade hypothesis. Science 256:184–185

Harris JA, Koyama A, Maeda S, Ho K, Devidze N, Dubal DB, Yu GQ, Masliah E, Mucke L (2012) Human P301L-mutant tau expression in mouse entorhinal-hippocampal network causes tau aggregation and presynaptic pathology but no cognitive deficits. PLoS One 7:e45881

Hyman BT, Van Hoesen GW, Damasio AR, Barnes CL (1984) Alzheimer’s disease: cell-specific pathology isolates the hippocampal formation. Science 225:1168–1170

Ingelsson M, Fukumoto H, Newell KL, Growdon JH, Hedley-Whyte ET, Frosch MP, Albert MS, Hyman BT, Irizarry MC (2004) Early Abeta accumulation and progressive synaptic loss, gliosis, and tangle formation in AD brain. Neurology 62:925–931

Jack CR Jr, Knopman DS, Jagust WJ, Petersen RC, Weiner MW, Aisen PS, Shaw LM, Vemuri P, Wiste HJ, Weigand SD, Lesnick TG, Pankratz VS, Donohue MC, Trojanowski JQ (2013) Tracking pathophysiological processes in Alzheimer’s disease: an updated hypothetical model of dynamic biomarkers. Lancet Neurol 12:207–216

Jellinger K, Braak H, Braak E, Fischer P (1991) Alzheimer lesions in the entorhinal region and isocortex in Parkinson’s and Alzheimer’s diseases. Ann N Y Acad Sci 640:203–209

Kovacs GG, Milenkovic I, Wohrer A, Hoftberger R, Gelpi E, Haberler C, Honigschnabl S, Reiner-Concin A, Heinzl H, Jungwirth S, Krampla W, Fischer P, Budka H (2013) Non-Alzheimer neurodegenerative pathologies and their combinations are more frequent than commonly believed in the elderly brain: a community-based autopsy series. Acta Neuropathol 126:365–384

Liu L, Drouet V, Wu JW, Witter MP, Small SA, Clelland C, Duff K (2012) Trans-synaptic spread of tau pathology in vivo. PLoS One 7:e31302

Lynch GS, Lucas PA, Deadwyler SA (1972) The demonstration of acetylcholinesterase containing neurones within the caudate nucleus of the rat. Brain Res 45:617–621

Manaye KF, Wang PC, O’Neil JN, Huang SY, Xu T, Lei DL, Tizabi Y, Ottinger MA, Ingram DK, Mouton PR (2007) Neuropathological quantification of dtg APP/PS1: neuroimaging, stereology, and biochemistry. Age 29:87–96

McKee AC, Kosik KS, Kowall NW (1991) Neuritic pathology and dementia in Alzheimer’s disease. Ann Neurol 30:156–165

Polydoro M, de Calignon A, Suarez-Calvet M, Sanchez L, Kay KR, Nicholls SB, Roe AD, Pitstick R, Carlson GA, Gomez-Isla T, Spires-Jones TL, Hyman BT (2013) Reversal of neurofibrillary tangles and tau-associated phenotype in the rTgTauEC model of early Alzheimer’s disease. J Neurosci 33:13300–13311

Polydoro M, Dzhala VI, Pooler AM, Nicholls SB, McKinney AP, Sanchez L, Pitstick R, Carlson GA, Staley KJ, Spires-Jones TL, Hyman BT (2013) Soluble pathological tau in the entorhinal cortex leads to presynaptic deficits in an early Alzheimer’s disease model. Neuropathol Acta 127:257–270

Pooler AM, Phillips EC, Lau DH, Noble W, Hanger DP (2013) Physiological release of endogenous tau is stimulated by neuronal activity. EMBO Rep 14:389–394

Pooler AM, Polydoro M, Wegmann SK, Pitstick R, Kay KR, Sanchez L, Carlson GA, Gomez-Isla T, Albers MW, Spires-Jones TL, Hyman BT (2013) Tau-amyloid interactions in the rTgTauEC model of early Alzheimer’s disease suggest amyloid-induced disruption of axonal projections and exacerbated axonal pathology. J Comp Neurol 521:4236–4248

Rasool S, Martinez-Coria H, Wu JW, LaFerla F, Glabe CG (2013) Systemic vaccination with anti-oligomeric monoclonal antibodies improves cognitive function by reducing Abeta deposition and tau pathology in 3xTg-AD mice. J Neurochem 126:473–482

Ribe EM, Perez M, Puig B, Gich I, Lim F, Cuadrado M, Sesma T, Catena S, Sanchez B, Nieto M, Gomez-Ramos P, Moran MA, Cabodevilla F, Samaranch L, Ortiz L, Perez A, Ferrer I, Avila J, Gomez-Isla T (2005) Accelerated amyloid deposition, neurofibrillary degeneration and neuronal loss in double mutant APP/tau transgenic mice. Neurobiol Dis 20:814–822

Santacruz K, Lewis J, Spires T, Paulson J, Kotilinek L, Ingelsson M, Guimaraes A, DeTure M, Ramsden M, McGowan E, Forster C, Yue M, Orne J, Janus C, Mariash A, Kuskowski M, Hyman B, Hutton M, Ashe KH (2005) Tau suppression in a neurodegenerative mouse model improves memory function. Science 309:476–481

Thal DR, Rub U, Orantes M, Braak H (2002) Phases of A beta-deposition in the human brain and its relevance for the development of AD. Neurology 58:1791–1800

Wu JW, Herman M, Liu L, Simoes S, Acker CM, Figueroa H, Steinberg JI, Margittai M, Kayed R, Zurzolo C, Di Paolo G, Duff KE (2013) Small misfolded Tau species are internalized via bulk endocytosis and anterogradely and retrogradely transported in neurons. J Biol Chem 288:1856–1870

Yamada K, Holth JK, Liao F, Stewart FR, Mahan TE, Jiang H, Cirrito JR, Patel TK, Hochgrafe K, Mandelkow EM, Holtzman DM (2014) Neuronal activity regulates extracellular tau in vivo. J Exp Med 211:387–393


Acceso al documento

  • APA
  • Autor
  • BIBTEX
  • Harvard
  • Estándar
  • RIS
  • Vancouver

Research output : Contribution to journal › Review article › peer-review

T1 - In vivo effects of ApoE and clusterin on amyloid-beta metabolism and neuropathology.

N2 - The epsilon4 allele of apolipoprotein E APOE is a risk factor for Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA), and the epsilon2 allele is associated with a decreased risk for AD. There is strong evidence to suggest that a major, if not the main, mechanism underlying the link between apoE and both AD and CAA is related to the ability of apoE to interact with the amyloid-beta (Abeta) peptide and influence its clearance, aggregation, and conformation. In addition to a number of in vitro studies supporting this concept, in vivo studies with amyloid precursor protein (APP) transgenic mice indicate that apoE and a related molecule, clusterin (also called apolipoprotein J), have profound effects on the onset of Abeta deposition, as well as the local toxicity associated with Abeta deposits both in the brain parenchyma and in cerebral blood vessels. Taken together, these studies suggest that altering the expression of apoE and clusterin in the brain or the interactions between these molecules and Abeta would alter AD pathogenesis and provide new therapeutic avenues for prevention or treatment of CAA and AD.

AB - The epsilon4 allele of apolipoprotein E APOE is a risk factor for Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA), and the epsilon2 allele is associated with a decreased risk for AD. There is strong evidence to suggest that a major, if not the main, mechanism underlying the link between apoE and both AD and CAA is related to the ability of apoE to interact with the amyloid-beta (Abeta) peptide and influence its clearance, aggregation, and conformation. In addition to a number of in vitro studies supporting this concept, in vivo studies with amyloid precursor protein (APP) transgenic mice indicate that apoE and a related molecule, clusterin (also called apolipoprotein J), have profound effects on the onset of Abeta deposition, as well as the local toxicity associated with Abeta deposits both in the brain parenchyma and in cerebral blood vessels. Taken together, these studies suggest that altering the expression of apoE and clusterin in the brain or the interactions between these molecules and Abeta would alter AD pathogenesis and provide new therapeutic avenues for prevention or treatment of CAA and AD.


MATERIALES Y MÉTODOS

Animales

B6.Cg-Tg(CAG-cre/Esr1)5Amc/J mice, which we referred to as CAG-Cre ERT2 mice, were obtained from The Jackson Laboratory (21). The B6.129S4- Meox2tm1(cre)Sor /J mice, which we referred to as Meox-Cre, were provided by M. Tallquist (24). Tg2576 mice were obtained from Taconic (38). Animals were group-housed in a standard 12-hour light cycle and fed standard mouse chow ad libitum. All animal care protocols were done in accordance with the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center and the University of Freiburg.

In light of the complexity of the genetic crosses and the different origins of the animal strains involved in this study, it has not been possible to conduct all experiments on a strictly homogenous C57Bl/6 strain background. To ensure a minimal effect of strain background on the behavioral results we have found, all animals that were compared were brother/sister crosses that only differ by the absence or presence of Cre recombinase. Moreover, discovering a robust response like the one discussed here in a mixed background, as opposed to an inbred one, further strengthens the validity of the conclusions, rather than diminishing them. It also further supports the applicability of the results to the even more genetically heterogeneous human population.

Generation of the Reln flox/flox ratón

To create the targeting vector for the Reelin cKO mouse line, pJB1 [described in (69)] was used as background vector, and murine SV129J embryonic stem (ES) cell DNA was used as template DNA to amplify the short homology arm (SA 1.35 kb), the fragment containing the first exon (EX1 1.25 kb), and the long homology arm (LA 9 kb). To incorporate the first loxP site, a Cla I and a Pvu I restriction site were included in the SA reverse and the EX1 forward primers, respectively. By three-fragment ligation, the (i) SA (cut with Sal I and Cla I) and (ii) EX1 (cut with Sal I and Pvu I) fragments were combined by a (iii) loxP coding linker (two annealed oligos with sticky ends for Cla I and Pvu I) and cloned between the Neo and HSVTK selection marker genes (Xho I site, compatible ends with Sal I) of pJB1. The resulting vector was opened with Not I to insert the 9-kb LA fragment 3′ downstream of the loxP/FRT-flanked neo cassette. The primers used were as follows: SA_forward, 5′- ATCGAT GTCGAC GGAAGTTTTGCTTCTTCCGGTG-3′ (Sal I) SA_reverse, 5′-CA ATCGAT GTTGTTTGTCTACGCCGGCTGCAAC-3′ (Cla I) EX1_forward, 5′-CCTTCTCG CGATCG CGCGTCCTCGCAGAACGGGCAGCC-3′ (Pvu I) EX1_reverse, 5′-GCGGCCGC GTCGAC TGGGCAGCCACCGACCAAAGTGCTC-3′ (Sal I) LA_forward, 5′-TGTT GCGGCCGC GGCGGCCAGTTAAAAGTTCCCGCTG-3′ (Not I) LA_reverse, 5′-GTCGAC GCGGCCGC TTCCATAAAAGGGAAGAGCAAGATG-3′ (Not I). The oligos used were loxP_forward, 5′- CG ATAACTTCGTATAGCATACATTATACGAAGTTAT AT -3′, and loxP_reverse, 5′- CGAT ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGAT -3′.

The final construct containing the SA-loxP-EX1-loxP-Neo-loxP-LA-HSVTK cassette was linearized and electroporated into SV129J ES cells. Gene targeting–positive ES cells [polymerase chain reaction (PCR) screen] were injected into C57Bl/6J blastocysts, resulting in chimeric mice. The chimeras were crossed to C57Bl/6J mice, resulting in Reln fl/wt mice, verified by PCR and Southern blot. Heterozygous animals were backcrossed to Meox-Cre on the BL6 background to yield germline mutant reeler ratones. Heterozygous animals were also backcrossed to CAG- CreERT2 mice to obtain homozygous Reln fl/fl CAG-Cre ratones. These were again backcrossed to Tg2576 mice, and offspring used in the experiments were brother/sister crossed CAG-Cre hemizygous and Tg2576 hemizygous mice. To ensure a minimal effect on the behavioral results we have found, all animals that were compared were brother/sister crosses that differed only by the absence or presence of Cre recombinase.

Tamoxifen injections

At 2 months of age, mice were given daily intraperitoneal injections for 5 days of tamoxifen (135 mg/kg Sigma) dissolved in sunflower oil. Control mice were injected with sunflower oil vehicle.

Anticuerpos

The following primary antibodies were used for the described experiments: NeuN (Millipore, Mab377 1:300), NMDAR2B (Cell Signaling, 4212S 1:2000), NR2A (Cell Signaling, 4205S 1:500), GluR1 (Abcam, ab7260 1:2000), GluR2/3 (Millipore, 07-598 1:2000), β-actin (Abcam, ab8227 1:3000), G10 [(70) 1:1000 for Western blotting, 1:500 for immunohistochemistry], 6E10 (Covance, SIG-39320), 4G8 (Covance, SIG-39220), Dab1 [5091 (71) 1:1000], phospho-GSK3β (Cell Signaling, 9336S 1:3000), GSK3β (BD Transduction, 610201 1:3000), phospho-Tau (Thr 231 ) (Invitrogen, 44746G 1:5000), AT8 (Thermo, #MN1020 1:2000), Tau-5 (Invitrogen, AHB0042 1:5000), phospho-Akt (Ser 473 ) (Cell Signaling, 9271S 1:1000), Akt (Cell Signaling, 9272S 1:1000), phospho-ERK (Cell Signaling, 4370 1:1000), ERK (Cell Signaling, 4696S 1:1000), phospho-Src (Biosource, 44660 1:1000), Src (Biosource, 44-656Z 1:1000), and receptor-associated protein (RAP) (692, 1:1000). Secondary antibodies used were goat anti-mouse Alexa Fluor 488 (Molecular Probes, 1:1000, for immunohistochemistry), donkey anti-rabbit ECL, horseradish peroxidase (HRP)–linked (Amersham, NA934 1:3000), and donkey anti-mouse 800 and donkey anti-rabbit 680 (LI-COR, 1:3000, for Western blotting).

Western blot

Mice were deeply anesthetized with isoflurane and decapitated, and the hippocampi and cortices were rapidly dissected on ice. Tissues were immediately flash-frozen in liquid nitrogen. The tissue was homogenized in radioimmunoprecipitation assay buffer [50 mM tris (pH 8.0), 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP40] with protease and phosphatase inhibitors and then centrifuged at 14,000 rpm for 15 min to remove debris and nuclei. To analyze tau protein, tissues were homogenized in buffer [0.1 M MES (pH 6.8), 0.5 mM MgSO4, 1 mM EGTA, 2 mM dithiothreitol, 0.5 M NaCl, 2 mM phenylmethylsulfonyl fluoride, 20 mM sodium fluoride, 0.5 mM sodium orthovanadate, 1 mM benzamidine, 25 mM β-glycerophosphate, 10 mM pag-nitrophenylphosphate, aprotinin (10 μg/ml), leupeptin (10 μg/ml), 1 μM okadaic acid] and then clarified at 14,000 rpm for 5 min at 4°C. The supernatant was boiled for 5 min in a water bath and then put on ice for 5 min the precipitated proteins were removed by centrifugation 14,000 rpm for 5 min. The supernatant was saved for analysis, as previously described (3). Protein concentration was determined using the Bio-Rad DC Protein Assay. Ten micrograms of protein was resolved on 4 to 15% Bio-Rad polyacrylamide gels and then transferred onto nitrocellulose membranes. The membranes were blocked in Odyssey (LI-COR) blocking buffer for 1 hour at room temperature and then incubated overnight in primary antibody. The membranes were protected from light and incubated with 1:3000 Odyssey secondary antibodies and then imaged on the Odyssey CLx Infrared Imaging System. Phosphorylated Src was quantified using ECL secondary antibody and developed using the SuperSignal West Femto Maximum Sensitivity Substrate because of low signal (Life Technologies). Blot quantification was performed using Image Studio software.

Behavioral characterization

All animals were allowed to acclimate in their home cage in the behavior facility for at least 1 hour before experimentation. Experiments were performed between 1400 and 1800. After completion of behavioral studies, Reelin knockout was confirmed by Western blot, and cKO mice that did not show greater than 95% reduction of Reelin in the forebrain were removed from data analysis.

Rotarod

Mice were placed on a Rotamex rotarod apparatus facing away from the experimenter. The rod was initially rotating at 2 rpm and then accelerated at a rate of 1 rpm/5 s until the mice fell off the rod or 300 s had passed. The time to falling off or the first “spin,” when the mouse completed a full rotation holding on to the rod, ended the trial. The mice received four trials per day over the course of 10 days with a 15-min inter-trial interval. The slowest of the four trials was excluded, and the remaining three trials were averaged.

Open field

Mice were individually placed in the center of a VersaMax animal activity monitor, which contained a 42 cm × 42 cm acrylic box with a small layer of bedding. Activity was measured by beam breaks over the course of 60 min in bins of 2 min each. Movement was analyzed using the VersaDat analysis software.

Elevated plus maze

Mice were placed at the center of the elevated plus maze, which consisted of two open arms and two closed arms. Mice were allowed to explore the maze for 5 min, and the time spent in each arm was scored automatically.

Prepulse inhibition

Mice were placed in an SR-LAB startle response system. After 5-min acclimation to a background 70-dB noise, the mice first received five 120-dB tones to record baseline startle. They were then given a series of pseudo-random pairings of a 120-dB tone immediately preceded by a 0-, 74-, 78-, or 86-dB tone. PPI was calculated as the percentage of the average startle at each decibel over the average startle at 0 dB (no tone). After PPI training, mice were tested for startle amplitude over a range of decibels from 70 to 120 dB.

Morris water maze

Mice received a 2-day pretraining before Morris water maze in which they were placed in a small tub (30.5 cm × 61 cm) to find a fixed, hidden platform. They received eight trials per day in which they were given 30 s to find the platform. Mice who did not reach the platform within 10 s for six of eight trials on the second day did not proceed to the Morris water maze. More than 95% of the mice passed the pretraining. For the Morris water maze, mice were placed in a 120-cm-diameter pool that was made opaque with white washable paint. A 10-cm-diameter platform was placed in the center of the northeast (“target”) quadrant of the pool, 1 cm under the surface of the water. Mice were placed in the pool starting in each of the four ordinary (N, S, E, W) directions in a pseudo-random order. A mouse was allowed 60 s to find the platform, and if unsuccessful, they were guided to the platform by the experimenter. After reaching the platform, mice remained there for 5 s before removal from the pool. Four trials happened per day, with a 5-min inter-trial interval. Mice were trained for a total of 10 days. On day 11, the platform was removed for the probe trial, in which the mice swam in the pool for 60 s, and the time spent in each quadrant was recorded. On day 12, the platform was moved to the southeast corner, and its location was made obvious using a flag for the visible probe trial. Mouse movements were recorded and analyzed by the HVS Water software (HVS Image).

Fear conditioning

On day 1, mice were placed in a shock chamber for a 6-min training period, during the last 3 min of which they were exposed to three pairings of a 20-s shock followed by a 2-s 0.6-mA shock. On day 2, mice were placed in the chamber without the tone for 3 min, and the extent of freezing was recorded. Four hours later, mice were placed in a different context for 7 min, and during the last 4 min, they received three exposures to the tone. Mouse freezing was recorded with the FreezeFrame program and analyzed using the FreezeView program (Actimetrics).

Histology and immunohistochemistry

Mice were sacrificed with isoflurane and perfused with 20 ml of ice-cold PBS followed by 20 ml of ice-cold 4% paraformaldehyde (PFA) in PBS. Brains were removed and postfixed in 4% PFA overnight at 4°C. Brains were immobilized in 5% agarose in PBS, and 50-μm-thick sections were sliced on a Leica VT1000 S vibratome. Sections were stored in 0.02% sodium azide in PBS at 4°C. For cresyl violet staining, sections were mounted on charged slides and dried at room temperature overnight. Slides were serially placed in 100% ethanol, 95% ethanol, and double-distilled water, and then stained in 0.1% cresyl violet. Slides were destained in 95% ethanol, then placed in 100% ethanol and xylene, and mounted. NeuN and Reelin immunohistochemistry was done by blocking slices in 3% goat serum for 3 hours at 4°C, then overnight in 1:300 NeuN or 1:500 G10 antibody. Alexa Fluor 594 goat anti-mouse secondary antibody was applied for 2 hours at room temperature, and then hippocampi were imaged at 20× for NeuN. Sequential images of the anti-Reelin sections were acquired using a 10× objective and stitched together using Microsoft Image Composite Editor. For Aβ immunostaining, sections were blocked in 3% H2O2 in methanol for 20 min, followed by 88% formic acid pretreatment for 3 min. The sections were blocked for 2 hours at room temperature with tris-buffered saline (TBS) containing 10% normal horse serum, 2% dl -lysine, 0.25% Triton-X, and a Fab mouse immunoglobulin G (IgG) (H&L) antibody fragment of anti-mouse IgG (1:1000 Rockland Immunochemicals Inc.). Aβ was detected with the antibody 4G8 (1:1000 Covance) followed by incubation with biotinylated anti-mouse IgG secondary antibody. Bound antibodies were visualized by using an ABC (avidin-biotin complex) kit (Vector Laboratories) and a diaminobenzidine kit (Sigma).

Golgi staining

Golgi staining was performed using the FD Rapid GolgiStain Kit (FD Neurotechnologies) according to the manufacturer’s instructions. Slices of 200-μm thickness were obtained with a vibratome (4). Z-sections of the Golgi-stained brains were acquired to measure the spine density of CA1 apical dendrites. Images were zoomed in 4× to measure the height and width of the spines.

Granule cell dispersion

Six serial sections of dorsal hippocampus were taken from each fixed brain and stained with cresyl violet. Images were taken at 20×. The length of the dentate gyrus was divided into 100-μm segments, and at the center of each segment, the width was measured. The average width per animal was taken for each norte.

Aβ quantification

Protein extraction from fresh-frozen mouse forebrain (0.4 g) was carried out in 1 ml of 1× TBS containing protease and phosphatase inhibitors. The tissue was homogenized with a micropestle (Eppendorf) followed by sonication. The homogenate was centrifuged for 30 min at 14,000gramo at 4°C. The supernatant (soluble fraction) was transferred into fresh tubes and kept at −80°C until further use. The remaining pellet was resuspended in 1 ml of PBS containing 1% Triton-X followed by sonication and centrifugation as previously mentioned. For the Aβ ELISA, the tissue was homogenized in PBS and then centrifuged at 14,000 rpm for 25 min at 4°C. The supernatant was reserved (soluble fraction), and the pellet was homogenized in 0.5 M guanidine, allowed to solubilize for 3 hours, and then spun at 14,000 rpm for 25 min (insoluble fraction). A sandwich ELISA was performed using antibodies donated by D. Holtzman. Briefly, Nunc MaxiSorp (Thermo) plates were coated with either HJ2 (anti-Aβ40) or HJ7.4 (anti-Aβ42) and incubated overnight at 4°C. Plates were then incubated with blocking buffer for 1.5 hours. Plates were incubated overnight with the soluble and insoluble tissue samples. The plates were then incubated with HJ5.1-biotin, which recognizes both forms of Aβ. The plates were coated with streptavidin–poly-HRP40 (Pierce) and then developed with Super Slow 3,3′,5,5′-tetramethylbenzidine (Sigma).

Field electrophysiology and θ-burst LTP

θ-Burst LTP was performed as previously described (2). Briefly, mice were deeply anesthetized with isoflurane, and their brains were quickly removed and placed in ice-cold high-sucrose slicing solution (110 mM sucrose, 60 mM NaCl, 3 mM KCl, 1.25 mM NaH2correos4, 28 mM NaHCO3, 0.5 mM CaCl2, 5 mM glucose, 0.6 mM ascorbic acid, 7 mM MgSO4). Transverse slices (350 μm) were cut using a Leica VT1000S vibratome. Slices were allowed to recover in ACSF (124 mM NaCl, 3 mM KCl, 1.25 mM NaH2correos4, 26 mM NaHCO3, 10 mM d -glucose, 2 mM CaCl2, 1 mM MgSO4) for 1 hour at room temperature before the experiments. For recording, slices were transferred to an interface chamber perfused with ACSF at 31°C. Slices were stimulated in the stratum radiatum with concentric bipolar electrodes (FHC) using an isolated pulse stimulator. The stimulus intensity was set to 40 to 60% of the maximum peak amplitude, as determined by measuring the input-output curve. After the baseline stabilized, a θ-burst was applied using a train of four 100-Hz pulses repeated 10 times with 200-ms intervals, and the train was repeated five times at 10-s intervals. The resulting LTP was measured for 1 hour after θ-burst stimulation. Data were analyzed using LabView 7.0.

Análisis estadístico

Data were analyzed with GraphPad Prism software (version 6.0, GraphPad Software). Data are shown as means ± SEM, and statistical significance was set at PAG & lt 0,05.


Ver el vídeo: Antibodies in VR: New Alzheimers disease drug, aducanumab Adulhem, bound to beta amyloid plaque (Diciembre 2022).