Información

¿Qué es un promotor subgenómico?

¿Qué es un promotor subgenómico?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy buscando una buena definición del término "promotor subgenómico". ¿Alguien me puede ayudar?


Un promotor subgenómico es un promotor añadido a un virus para un gen heterólogo específico, lo que da como resultado la formación de ARNm para ese gen solo. Muchos virus de ARN de sentido positivo producen estos ARNm subgenómicos (ARNsg) como una de las técnicas de infección comunes utilizadas por estos virus y generalmente transcriben genes virales tardíos. Desde doi: 10.1128 / jvi.74.13.5988-5996.2000

Entonces parece ser un promotor agregado que ayuda a expresar ciertos genes. Suele ser útil en ingeniería viral.


ARNm subgenómico

Los ARNm subgenómicos de los alfavirus y del virus de la rubéola se traducen como poliproteínas, sin embargo, el procesamiento de la poliproteína difiere entre los dos. Con los alfavirus, la proteína de la cápside se escinde autoproteolíticamente del precursor E2 (conocido como PE2 o P62) en el citoplasma y la poliproteína restante se transloca al lumen del ER, donde se produce la adición de oligosacáridos ligados a N. La proteína hidrófoba 6K, que se encuentra principalmente en la membrana del RE, es luego escindida de la poliproteína por la signalasa del hospedador. Con el virus de la rubéola, la signalasa completa las escisiones de la cápside-E2 y E2-E1. Además, el virus de la rubéola carece de la proteína 6K y la E2 madura se produce en el RE. Las proteínas alfavirus PE2 y E1 forman heterodímeros en el RE que están anclados por sus dominios transmembrana e implican enlaces disulfuro intra e intermoleculares y asociaciones con proteínas chaperonas del huésped como Bip y calnexina / calreticulina. Los heterodímeros PE2 / E1 se encaminan a la membrana citoplasmática y PE2 se escinde en E2 maduro por una proteasa similar a la furina del huésped como un evento tardío, en una estructura entre los trans Red de Golgi y superficie celular. El fragmento E3 escindido se pierde de algunas (p. Ej., SINV), pero no de todas (p. Ej., SFV) partículas de virus. Los viriones que contienen PE2 parecen brotar normalmente de células de vertebrados, pero a menudo tienen defectos en los reordenamientos conformacionales asociados con la fusión celular, lo que respalda la hipótesis de que la presencia de PE2 estabiliza el heterodímero de glicoproteína durante la exposición a pH bajo en la vía secretora.

La gemación de partículas ocurre a través de una interacción entre C y la cola citoplásmica de E2; sin embargo, no está claro en qué punto de la vía secretora ocurre esta interacción y si la interacción es entre monómeros C, oligómeros o nucleocápsidas preformadas que contienen ARN. Con los alfavirus, el empaquetamiento de ARN está dirigido por una estructura secundaria de ARN en los genes nsP1 o nsP2, dependiendo del virus, lo que lleva a empaquetamiento selectivo del genoma sobre el subgenoma, que está en exceso molar. En el modelo aceptado, la gemación final ocurre en la membrana citoplasmática en sitios enriquecidos en heterodímeros E2 / E1 y es impulsada por interacciones E2 cola-C que fuerzan la extrusión de la bicapa lipídica del hospedador, la envoltura de la partícula y la liberación.


Disección del requisito de secuencias promotoras subgenómicas mediante recombinación de ARN del virus del mosaico del bromo in vivo: evidencia de la separación funcional de la transcripción y la recombinación

Previamente, nosotros y otros mapeamos un aumento de la actividad de recombinación homóloga dentro de la región del promotor subgenómico (sgp) en el virus del mosaico del bromo (BMV) RNA3. Con el fin de correlacionar la recombinación y la transcripción mediadas por sgp, en el presente trabajo utilizamos construcciones de BMV RNA3 que llevaban repeticiones de sgp alteradas. Observamos que la eliminación o extensión del tracto poli (U) redujo o aumentó la recombinación, respectivamente. La eliminación de la horquilla del núcleo de sgp o su reemplazo por una estructura de tallo-bucle diferente inhibió la actividad de recombinación. Las sustituciones de nucleótidos en la posición de inicio de la transcripción +1 o +2 redujeron la recombinación. El núcleo sgp solo soportó solo la actividad de recombinación basal. Los sitios de cruces mapeados en la región poli (U) y en la horquilla del núcleo. Los efectos observados sobre la recombinación no fueron paralelos a los observados para la transcripción. Para explicar cómo operan ambas actividades dentro de la secuencia sgp, proponemos un mecanismo dual mediante el cual la recombinación se ceba en el tracto poli (U) por la cadena más naciente predetendida, mientras que la transcripción se inicia de novo en el núcleo sgp.

Cifras

Construcciones de BMV RNA3 (ID RNA3) ...

Construcciones de BMV RNA3 (ID RNA3) utilizadas en estos estudios. Un esquema del ...

Construcciones de BMV RNA3 (ID RNA3) ...

Construcciones de BMV RNA3 (ID RNA3) utilizadas en estos estudios. Un esquema del ...

Ilustración general de cruces homólogos ...

Ilustración general de cruces homólogos que ocurren entre dos variantes coinoculadas de ID RNA3.…

(A) Análisis de transferencia Northern de ...

(A) Análisis de transferencia Northern de la acumulación de construcciones BMV RNA3 ID. Sale de…

(A) Análisis de transferencia Northern de ...

(A) Análisis de transferencia Northern de la acumulación de construcciones BMV RNA3 ID. Sale de…

Resultados de la secuenciación de RT-PCR generados ...

Resultados de la secuenciación de clones de ADNc generados por RT-PCR de la progenie BMV RNA3 extraídos de…

Mapeo de los sitios de cruce ...

Mapeo de los sitios de cruce al tracto poli (U) basado en ID1 ×…

Representación esquemática del modelo ...

Representación esquemática del modelo de cruces en la región sgp. Líneas gruesas, ...


RESULTADOS

Iniciación subgenómica precisa.

Para determinar los elementos de reconocimiento contenidos en el promotor del núcleo subgenómico, se construyó un proscrito de 33 nt (& # x0221220 & # x0002f13) que contiene la secuencia del promotor WT 20 nt 3 & # x02032 del sitio de inicio de inicio subgenómico en (& # x02212) - cadena de ARN3. Esta proscripción dirige la síntesis de un producto de 13 nt, los primeros 11 nt de los cuales son la secuencia de BMV seguida de dos guanilatos añadidos por la ARN polimerasa de T7 para permitir el etiquetado de los productos RdRp con & # x0005b & # x003b1- 32 P & # x0005dCTP. La secuencia de BMV dentro de proscript & # x0221220 & # x0002f13 es complementaria al ARN3 de cadena viral (& # x0002b) desde las posiciones 1222 a 1252 y sirve como control WT (Fig. & # X200B (Fig. A).

Regiones en el promotor subgenómico de BMV necesarias para el inicio preciso y eficiente de la síntesis de ARN. (A) Mutantes de triple transversión. La secuencia mostrada es proscript & # x0221220 & # x0002f13 que contiene el promotor del núcleo WT BMV que dirige la síntesis de un producto de 13 nt. Los cambios de nucleótidos, en grupos de tres, en proscritos se muestran entre paréntesis y los nucleótidos mutantes se muestran debajo de la secuencia WT. La identidad de las plantillas de entrada, en reacciones duplicadas, se indica en la parte superior del gel. Los productos de reacción se separaron desnaturalizando PAGE (carriles 1 & # x0201316) y se visualizaron por autorradiografía. El producto RdRp predominante fue de 14 nt según se juzgó por comparación con un marcador de tamaño de 13 nt (carril M) debido a la adición no planificada de un nucleótido, posiblemente por RdRp. Lane & # x003c6 representa los productos de una reacción de control sin plantilla añadida. La región del promotor subgenómico requerida para la actividad está entre corchetes debajo del gel. (B) Requisitos de secuencia para el inicio preciso de la síntesis de ARN. La secuencia del promotor WT se muestra en la parte superior. Los ARN con secuencias de iniciación alteradas se muestran a continuación. El nucleótido iniciador (WT o mutante) se indica con una flecha y una fuente de mayor tamaño. STD indica productos de una reacción RdRp estándar (carriles 1, 4 y 7) y las reacciones que carecen de GTP se indican mediante & # x02212GTP (carriles 3, 6 y 9). La digestión con RNasa T1 de los productos RdRp se indica con & # x0002bT1 (carriles 2, 5 y 8). Los marcadores de tamaño (carril M) indican el tamaño de los productos RdRp. Se muestran los productos de reacciones sin plantilla añadida (carril & # x003c6).

Se crearon varias mutaciones dentro de la secuencia promotora. Inicialmente, las transversiones, en grupos de tres nucleótidos, se sintetizaron para escanear todo el promotor y determinar qué regiones eran necesarias para la síntesis de ARN. Se identificó que las posiciones & # x0221217 a & # x022129 contenían nucleótidos esenciales porque las mutaciones en esta región del promotor reducían la capacidad de la RdRp del BMV para iniciar la síntesis de ARN subgenómico a aproximadamente 2 & # x00025 de la actividad WT (Fig. & # X200B ( Figura 1 1 A, carriles 5 & # x0201310). Las mutaciones en las posiciones de los nucleótidos & # x022125 a & # x022123 tuvieron un efecto menor, reteniendo el 16 & # x00025 de la actividad WT (Fig. & # X200B (Fig.1 1 A, carriles 13 y 14). Cada una de las tres transversiones de nucleótidos que cubren todas las demás posiciones del promotor central solo redujo la síntesis en 50 & # x00025. El producto RdRp predominante de todas las plantillas fue 14 nt debido a la adición no plantilla de un nucleótido, un fenómeno común a todas las ARN polimerasas dependientes de ADN y el poliovirus RdRp (11).

Inesperadamente, la síntesis subgenómica no se vio relativamente afectada por el reemplazo de nucleótidos desde & # x022122 al sitio de iniciación, & # x0002b1 (Fig. & # x200B 1 1 A, carriles 15 y 16). Trabajos previos han demostrado que debe mantenerse la identidad del citidilato iniciador para el ARN4 subgenómico (6). La transversión de tres nucleótidos en la proscripción & # x022122 & # x0002b1 coloca un citidilato en la posición & # x022121 y es concebible que BMV RdRp pueda utilizar este nucleótido para el inicio de la síntesis de ARN dirigiendo un producto del mismo tamaño que la proscripción WT facilitando el uso de un guanilato sin plantilla (en lugar del citidilato con plantilla en la posición & # x0002b1) o evitando la posición & # x0002b1 por completo. Para probar si la posición de inicio se puede mover, se hicieron dos proscripciones adicionales (Fig. & # X200B (Fig.1 1 B). Proscript & # x0002b1 C & # x0002fG reemplaza específicamente el citidilato de inicio con un guanilato, dejando todas las demás posiciones como secuencia WT. Proscript & # x022121 & # x0002f & # x0002b1 G inserta un guanilato en el sitio de iniciación y mueve el citidilato WT & # x0002b1 a la posición & # x0002b2. Esta proscripción codifica un producto de 14 nt (15 nt con adición no planificada) si el guanilato insertado en la posición & # x0002b1 es reconocido por BMV RdRp. Sin embargo, si el sitio de iniciación se puede desplazar al citidilato que ahora ocupa la posición & # x0002b2, entonces debe observarse un producto de 13 nt (14 nt con adición no planificada). La iniciación precisa de los productos RdRp puede verificarse reteniendo el GTP que se requiere solo para la iniciación o mediante el tratamiento con RNasa T1 que escinde específicamente después de los guanilatos. Por tanto, un producto RdRp iniciado correctamente disminuirá 1 nt después de la digestión con RNasa T1.

Los productos RdRp de proscripts & # x022122 & # x0002b1, & # x022121 & # x0002f & # x0002b1 G, y WT & # x0221220 & # x0002f13 se iniciaron con GTP a juzgar por las reacciones que carecían de GTP y por el tratamiento con RNasa T1 (Fig. & # X200B (Figura 1 1 B, carriles 1 & # x020139) y tienen el mismo tamaño (13 y 14 nt) que los marcadores de tamaño T7. Sin embargo, no se sintetizó ningún producto a partir de la proscripción & # x0002b1 C & # x0002fG (Fig. & # X200B (Fig.1 1 B, carril 10). Por lo tanto, llegamos a la conclusión de que se requiere un residuo de citidilato como nucleótido de inicio, de acuerdo con observaciones anteriores. Parece que BMV RdRp puede reconocer un citidilato en un nucleótido 3 & # x02032 o 5 & # x02032 proximal al sitio de inicio original (Fig. & # X200B (Fig.1 1 B, carriles 4, 5, 7 y 8). Todas las reacciones demuestran un inicio preciso y validan el uso de este sistema para la caracterización de la interacción RdRp-promotor del núcleo subgenómico. Estos experimentos también confirman que la adición del nucleótido no moldeado que genera el producto de 14 nt se produce en el extremo 3 & # x02032 del producto de la cadena (& # x0002b).

Nucleótidos críticos para el inicio de la síntesis de ARN subgenómico.

Los datos de las tres transversiones de nucleótidos indicaron que las posiciones & # x0221217 a & # x022129 contienen nucleótidos importantes para la síntesis de ARN. Para identificar los residuos críticos, se construyeron proscritos que contienen transversiones de un solo nucleótido en cada posición dentro de esta región y en las posiciones & # x022125 a & # x022123 del promotor del núcleo subgenómico (Fig. & # X200B (Fig. A). Las posiciones & # x0221217, & # x0221214, & # x0221213, & # x0221211, & # x0221210 y & # x022125 fueron importantes para la síntesis porque las transversiones disminuyeron significativamente la síntesis de ARN por el BMV RdRp (Fig. & # X200B (Fig. A, carriles 2, 5, 6, 8, 9 y 11). Las posiciones más críticas, & # x0221217, & # x0221214, & # x0221213 y & # x0221211, todas tenían actividades por debajo del 3 & # x00025 de la proscripción WT. Los cambios en las posiciones & # x0221210 y & # x022125 fueron menos severos, reteniendo 31 & # x00025 a 18 & # x00025 de síntesis de WT. Como control negativo, no se observó síntesis de un proscrito, & # x0002b1 C & # x0002fG, que contiene una transversión en la posición & # x0002b1 (Fig. & # X200B (Fig. A, carril 14).

Análisis mutacional del promotor del núcleo subgenómico de BMV. Los carriles que contienen los productos de reacción RdRp de proscritos de entrada se indican junto a los nombres de proscriptos en cada esquema. Todos los productos se separaron en geles de poliacrilamida desnaturalizantes 20 & # x00025. Debido a que estas autorradiografías no contienen bandas distintas de los productos RdRp de los tamaños esperados, solo se muestran las partes de la autorradiografía que contienen los productos RdRp. El carril & # x003c6 indica productos elaborados a partir de reacciones que carecen de plantilla de entrada, mientras que el carril M contiene un marcador de tamaño de 13 nt, generado por la ARN polimerasa de T7, de secuencia idéntica al producto RdRp esperado. Los productos de proscriptos que apoyan la síntesis se iniciaron con precisión según se juzgó por comparación con los marcadores de tamaño y la construcción WT. (A) Mutaciones de transversión de un solo nucleótido en los nucleótidos & # x0221217 a & # x022129, & # x022125 a & # x022123, y & # x0002b1. Las secuencias de nucleótidos de la plantilla WT (& # x0221220 & # x0002f13) y los cambios correspondientes se muestran con las tres transversiones de nucleótidos originales entre corchetes. (B) Todos los posibles reemplazos de nucleótidos en las posiciones & # x0221217, & # x0221214 y & # x0221213. La secuencia del proscrito WT (& # x0221220 & # x0002f13) se muestra con los cambios apropiados indicados a continuación. (C) Todos los posibles reemplazos de nucleótidos en las posiciones & # x0221211 y & # x0221210. Se muestra el esquema del proscrito de WT y la identidad de los mutantes posteriores se indica a continuación.

Se ensayaron proscritos que contenían todos los posibles reemplazos de nucleótidos en las posiciones más críticas, & # x0221217, & # x0221214, & # x0221213 y & # x0221211, para probar la especificidad de secuencia de estas cuatro posiciones. Un cambio del guanilato de WT a uridilato (& # x0221217 G & # x0002fU) en la posición & # x0221217 apoyó la síntesis de ARN en 13 & # x00025 de la actividad de WT (Fig. & # X200B (Fig. B, carril 2). Otras sustituciones de nucleótidos en & # x0221217 (& # x0221217 G & # x0002fC y & # x0221217 G & # x0002fA) no pudieron dirigir la síntesis de ARN (Fig. & # X200B (Fig. B, carriles 1 y 3). Los nucleótidos distintos de la secuencia WT en las posiciones & # x0221214 o & # x0221213 no retuvieron una actividad apreciable (Fig. & # X200B (Fig.2 2 B, carriles 4 & # x020139), lo que demuestra la importancia del adenilato en & # x0221214 y del citidilato en & # x0221213. Un cambio en la posición & # x0221211 del guanilato de WT a uridilato o adenilato (& # x0221211 G & # x0002fU o & # x0221211 G & # x0002fA) retuvo aproximadamente 8 & # x00025 actividad, mientras que la proscripción original & # x0221211 G & # x0002fC solo tenía 1 & # x00025 de la actividad del proscrito WT (Fig. & # X200B (Fig.2 2 C, carriles 1 & # x020133). Para demostrar aún más los requisitos específicos de las cuatro posiciones anteriores, el guanilato WT en la posición & # x0221210 se reemplazó con un uridilato o un adenilato sin efectos perjudiciales (Fig. & # X200B (Fig.2 2 C, carriles 5 y 6). De hecho, ambos mutantes, & # x0221210 G & # x0002fU y & # x0221210 G & # x0002fA, dieron como resultado promotores ligeramente mejores que el proscrito WT, generando 140 & # x00025 del producto de & # x0221220 & # x0002f13. Estos resultados demuestran la especificidad de nucleótidos en las posiciones & # x0221217, & # x0221214, & # x0221213 y & # x0221211 del promotor del núcleo subgenómico de BMV.

En la Fig. & # X200B se presenta un resumen de todos los datos mutacionales Fig.3 3 A. El examen de los restos funcionales de la base en los nucleótidos de reemplazo que mostraron actividad parcial sugiere sitios de contacto reconocidos por BMV RdRp. Para probar esta idea, se realizaron experimentos de competencia para determinar si los proscritos & # x0221220 & # x0002f13, & # x0221217 G & # x0002fC y & # x0221217 G & # x0002fU afectarían la síntesis de un segundo proscrito con la secuencia del promotor WT que dirige la síntesis de un 15 -nt producto (designado & # x0221220 & # x0002f15). La concentración de las plantillas de la competencia se varió desde un exceso molar de 0,1 a 10 veces del proscrito & # x0221220 & # x0002f15. La competencia se visualizó mediante una cantidad decreciente del producto de 15 nt con un aumento simultáneo del producto de 13 nt (Fig. & # X200B (Fig. B). Como era de esperar, proscript & # x0221220 & # x0002f13 compitió eficientemente por la síntesis porque también contiene un promotor subgenómico WT (Fig. & # X200B (Fig. B, carriles 4 & # x020138). La síntesis de & # x0221220 & # x0002f15 se redujo 50 & # x00025 cuando & # x0221220 & # x0002f13 estaba presente en una cantidad equimolar. En contraste, proscript & # x0221217 G & # x0002fC no era un competidor efectivo, disminuyendo la síntesis de & # x0221220 & # x0002f15 en solo 15 & # x00025 cuando estaba presente en una proporción equimolar (Fig. & # X200B (Fig. B, carriles 9 y # x0201313). La proscripción de & # x0221217 G & # x0002fU inhibió la síntesis de & # x0221220 & # x0002f15 a un nivel reducido (35 & # x00025) del observado con & # x0221220 & # x0002f13 (Fig. & # X200B (Fig. 33) B, carriles 14 & # x0201318). Este nivel de inhibición es consistente con el resultado de que la síntesis de esta plantilla mutante disminuyó pero no se anuló (Fig. & # X200B (Fig.2 2 B, carril 2). El resultado de este experimento es consistente con la idea de que la posición & # x0221217, y muy probablemente los otros nucleótidos clave identificados por mutagénesis, son contactados por BMV RdRp.

(A) Resumen del análisis mutacional del promotor subgenómico de BMV. La secuencia WT está en negrita mostrada horizontalmente con posiciones relativas de nucleótidos marcadas arriba. Los porcentajes en rectángulos por encima de la secuencia promotora representan la actividad relativa de los mutantes de triple transversión originales. La clave para los cambios de nucleótidos está en el lado izquierdo. Los valores enumerados debajo de la secuencia de WT representan el porcentaje de actividad de los mutantes de un solo nucleótido en comparación con el proscrito de WT. Los grupos funcionales previstos necesarios para los nucleótidos en las posiciones & # x0221217, & # x0221214, & # x0221213 y & # x0221211 se indican debajo de las flechas. (B) Contactos de unión potenciales dentro del promotor del núcleo subgenómico. Competencia entre un promotor WT que dirige la síntesis de un producto de 15 nt (& # x0221220 & # x0002f15) y una de las tres plantillas de la competencia que codifican productos de 13 nt: & # x0221220 & # x0002f13, que contiene la secuencia del promotor subgenómico WT BMV & # x0221217 G & # x0002fC, una plantilla mutante no funcional & # x0221217 G & # x0002fU, una plantilla parcialmente funcional.La reacción en el carril 1 se realizó sin ninguna plantilla de entrada mientras que las reacciones en los carriles 2 & # x0201318 contienen cada una 25 nM de la plantilla & # x0221220 & # x0002f15 con la identidad y la cantidad de plantilla competidora indicadas encima de la autorradiografía. Las identidades de los productos RdRp y sus tamaños se indican a cada lado de la autorradiografía.

Promotores subgenómicos alfavirales.

Una comparación del promotor subgenómico del BMV con los de otros miembros de la superfamilia tipo alfavirus, que infecta tanto a plantas como a animales, revela una conservación sorprendente de los cuatro nucleótidos críticos para la síntesis por el RdRp del BMV (Fig. & # X200B (Fig. 4) 4 A). Además, todos estos promotores contienen una pirimidina como nucleótido iniciador (uridilato en virus animales y un citidilato o uridilato en virus vegetales) con un adenilato altamente conservado en la posición & # x0002b2. Esta similitud implica que las RdRps de los miembros de la superfamilia de tipo alfavirus reconocen los promotores subgenómicos mediante un mecanismo conservado.

Conservación de los promotores del núcleo subgenómico en la superfamilia similar a alfavirus. (A) Alineación de promotores subgenómicos de virus tanto animales como vegetales. Los nucleótidos conservados en el promotor central se muestran en negrita. Las secuencias se obtuvieron de la base de datos GenBank. Los elementos homopoliméricos aguas arriba, cuando están presentes, se indican entre paréntesis. SFV, virus del bosque de Semliki RRV, virus de Ross River MBV, virus de Middelburg SBV, virus de Sindbis CMV, virus del mosaico del pepino AMV, virus del mosaico de la alfalfa BBMV, virus del moteado de la haba CCMV, virus del moteado clorótico del caupí, virus del mosaico del bromo. La alineación se generó utilizando el programa de software clustalw. Las posiciones & # x0221217, & # x0221214, & # x0221213 y & # x0221211 se indican debajo de la secuencia de BMV & # x0002b1 denota el nucleótido de iniciación. (B) BMV RdRp reconoce el promotor subgenómico de SFV. Se muestra un esquema de proscritos que contienen el promotor subgenómico WT para BMV o SFV con el nucleótido de inicio indicado por la flecha. El producto de 13 nt del proscrito BMV & # x0221220 & # x0002f13 se muestra en el carril 1. El proscrito SFV codifica un producto de 11 nt que requiere un adenilato para una iniciación correcta (carriles 2 & # x020135). Las cantidades de molde (en pmol) utilizadas en una reacción de RdRp se muestran en la parte superior del gel. ATP indica ausencia de ATP en la reacción. M indica un marcador de tamaño de 13 nt producido por la ARN polimerasa de T7, y & # x003c6 indica una reacción sin molde añadido.

Para examinar la posibilidad de que se conserve el modo de reconocimiento de la plantilla, construimos un proscrito que contenía el promotor subgenómico de SFV (12, 13) y probamos su capacidad para ser reconocido por BMV RdRp (Fig. & # X200B (Fig.4 4) B). Para que el producto de ARN pueda distinguirse visualmente del producto de 13 nt generado a partir del proscrito de BMV, el proscrito de SFV se diseñó para dirigir la síntesis de un producto de 11 nt, los primeros 9 nt de los cuales son la secuencia de WT SFV seguida de dos guanilatos. agregado por T7 RNA polimerasa para permitir el etiquetado de productos RdRp con & # x0005b & # x003b1- 32 P & # x0005dCTP. El proscrito de SFV indica al BMV RdRp que sintetice un producto que depende del ATP, que se utiliza únicamente como nucleótido iniciador para la síntesis subgenómica a partir de este molde (Fig. B, carriles 2 & # x020135). La cantidad de síntesis fue sólo 0,25 & # x00025 de la síntesis de una cantidad equimolar de WT & # x0221220 & # x0002f13 pero significativamente por encima del fondo. Este resultado demuestra una interacción heteróloga entre una RdRp de un virus que infecta a las plantas con una plantilla de ARN que contiene el promotor subgenómico de un virus que infecta a los animales.


RESULTADOS

Norovirus RdRps puede sintetizar específicamente ARN a partir de sus promotores centrales subgenómicos

Presumimos que el norovirus RdRp es el componente en el complejo de replicasa que reconoce los promotores centrales para la síntesis de ARN viral sgRNA. Las RdRps virales recombinantes pueden usar típicamente una amplia variedad de moldes de ARN para la síntesis de ARN y, por lo tanto, no se ha pensado que reconozcan específicamente los elementos promotores virales excepto el nucleótido de iniciación (30,31). Se diseñaron cinco promotores / plantillas de ARN para examinar la especificidad de la síntesis de ARN (Figura & # x200B (Figura1A). 1A). Tres de los ARN contenían promotores del núcleo subgenómico víricos seguidos de secuencias molde cortas. En aras de la brevedad, estos ARN se denominan & # x02018proscripts & # x02019. El MNV, el norovirus humano GII.4 y los proscritos del virus de la hepatitis E (HEV) se denominan, respectivamente, Mps, Gps y Hps (Figura & # x200B (Figura1A). 1A). Los dos ARN restantes, PE19 y PE46, no contienen secuencias promotoras, pero se utilizaron previamente para, respectivamente, de novo síntesis de ARN iniciada y dependiente de cebadores por el virus de la hepatitis C RdRp (32).

Los RdRps de norovirus recombinantes pueden iniciar la síntesis de ARN a partir de sus proscritos. (A) Secuencias y estructuras de ARN predichas de cinco ARN probados para la síntesis de ARN mediante RdRps recombinantes. Los nombres de los ARN están en negrita. Cuando está presente, el residuo de iniciación de la plantilla está subrayado. MpsIM mutante y GpsIM es una versión de Mps y Gps con el citidilato de iniciación sustituido por un adenilato. Mps predijo la estructura secundaria del aislado MNV CW1 (<"type": "entrez-nucleotide", "attrs": <"text": "DQ285629", "term_id": "82754799", "term_text": "DQ285629"> > DQ285629), nt 5012 a 5059. Gps la secuencia y la estructura secundaria predicha del aislamiento GII.4 Hu / GII.4 / MD-2004/2004 / US (<"type": "entrez-nucleotide", "attrs" : <"text": "DQ658413", "term_id": "110164874", "term_text": "DQ658413" >> DQ658413), nt 5044 a 5085. Hps predijo la estructura secundaria del aislado de HEV genotipo 3 Kernow C1 (<" escriba ":" entrez-nucleotide "," attrs ": <" text ":" JQ679013 "," term_id ":" 380083199 "," term_text ":" JQ679013 ">> JQ679013), nt 5317 a 5361. (B) Los ARN utilizados para la síntesis de ARN existen en una conformación predominante en solución. La imagen superior del gel muestra los ARN utilizados en el análisis de este manuscrito separados en un gel de poliacrilamida al 15% modificado con urea 7,5 M. La imagen del gel inferior contiene ARN separados en un gel de poliacrilamida al 15% que carece de urea. Los ARN se tiñeron con azul de toluidina. (C) Productos de ARN elaborados por RdRps a partir del norovirus humano GII.4, MNV y HCV. Productos iniciados correctamente por un de novo mecanismo y terminados después de que el término 3 & # x02032 de la plantilla se identifiquen con asteriscos. La imagen del gel se obtuvo usando un Phosphorimager de un gel de poliacrilamida al 24% que contiene 7,5 M de urea. Las longitudes de los ARN iniciados de novo se derivaron de análisis previos en los que los productos de MNV RdRp se sometieron a electroforesis junto con productos de longitudes conocidas. (D) Proscripciones con sustituciones del T + 1 citidilato no puede dirigir de novo iniciación de productos de ARN por el MNV y el GII.4 RdRps. Los productos de la extensión de imprimación (PE) y de novo se muestran la iniciación (DN). Los ARN que se inician y terminan correctamente a partir de Mps y Gps son, respectivamente, 11 y 8 nt.

Las estructuras de la horquilla subgenómica de MNV y GII.4 se conservan y se ha demostrado que el emparejamiento de bases en la horquilla de MNV es necesario para una infección eficaz por MNV (24). El programa informático Mfold también muestra que la estructura de horquilla es termodinámicamente más estable en el contexto de los ARN proscritos (datos no mostrados). Sin embargo, para determinar si los proscritos de MNV y GII.4 formarán una estructura de ARN predominante en solución, analizamos los ARN mediante electroforesis en gel de poliacrilamida desnaturalizante y no desnaturalizante. Este análisis se utilizó previamente para caracterizar la idoneidad de los ARN para la espectroscopia de RMN (33,34). En los geles desnaturalizantes, todos los ARN migraron en sus longitudes esperadas (Figura & # x200B (Figura1B). 1B). En los geles no desnaturalizantes, los ARN también formaron una banda, lo que sugiere que Mps y Gps forman una estructura de ARN predominante en solución (Figura & # x200B (Figura 1B). 1B). Los ARN Mhp y Ghp que contienen las estructuras de horquilla también formaron una estructura predominante en solución (Figura & # x200B (Figura 1B 1B).

Se probaron RdRps recombinantes altamente purificados del MNV, el norovirus humano GII.4 y el VHC para determinar su capacidad para usar los cinco ARN para la síntesis de ARN. El inicio preciso de la síntesis de ARN a partir de los nucleótidos que dirigen la síntesis de ARNg durante la infección debe producir productos que sean distinguibles en longitud. Mps, Gps y Hps deberían, respectivamente, producir ARN de 11 nt, 8 nt y 24 nt. LE19P dirige la síntesis de un de novo iniciado producto de 19 nt. También contiene una puromicina terminal 3 & # x02032 que bloquea la extensión del cebador. PE46 forma un ARN auto-recocido estable cuyo extremo 3 & # x02032 puede extenderse por varias RdRps para formar un ca. Producto de ARN de 46 nt (32).

De acuerdo con los resultados anteriores, HCV RdRp formó productos de extensión de cebadores a partir de PE46 que tenían una longitud de 46 nt y una de novo-ARN iniciado de LE19P (Figura & # x200B (Figura 1C). 1C). La RdRp de AVC no produjo cantidades significativas de de novo productos iniciados de las tres proscripciones. En cambio, los productos generados tenían longitudes más largas que las proscripciones (Figura & # x200B (Figura 1C). 1C). Es probable que estos productos se deban a la extensión del cebador de los ARN cuando los extremos 3 & # x02032 de los proscritos se aparearon con las regiones monocatenarias del proscrito (Figura & # x200B (Figura 1C). 1C). Por tanto, los cinco ARN son capaces de dirigir alguna forma de síntesis de ARN por la RdRp del VHC, aunque la RdRp del VHC no utilizó preferentemente los nucleótidos molde de iniciación de los tres proscritos.

El MNV RdRp produjo productos principales de aprox. 50, 11 y 10 nt de Mps. La CA. El producto de 50 nt probablemente surgió por extensión del cebador. El producto de 11 nt probablemente se inició a partir del citidilato de iniciación en la plantilla (que se llamará T + 1 citidilato) y terminó al final de la secuencia molde en el proscrito. El producto de 10 nt probablemente surgió de de novo iniciación desde el T + 1 citidilato pero terminó un nucleótido antes de que RdRp alcanzara los 3 & # x02032 nucleótidos finales del ARN molde. Se ha informado la terminación prematura de la síntesis de ARN para varias RdRps recombinantes in vitro (35,36). Para confirmar que MNV RdRp puede iniciar con precisión la síntesis de ARN a partir del T + 1 citidilato, usamos proscript MpsIM, que tiene la misma secuencia que Mps excepto por una sustitución de adenilato en el T + 1 puesto. MpsIM no dirigió la síntesis del producto de 11 o 10 nt, pero generó productos de extensión del cebador más largos que la plantilla de entrada (Figura & # x200B (Figura 1D). 1D). Este resultado demuestra que MNV RdRp puede iniciar con precisión la síntesis de ARN a partir de Mps. Curiosamente, en múltiples ensayos, el producto de imprimación extendida fue más abundante con MpsIM que con Mps, lo que sugiere que la falta de de novo La síntesis de ARN iniciada permitió que RdRp participara en la síntesis de ARN dependiente de cebadores.

El MNV RdRp produjo solo una baja abundancia de 8-nt de novo producto iniciado de la proscripción GII.4, Gps. También se produjo un producto de 7 nt que se inició correctamente, pero terminó 1 nt menos que el 3 & # x02032 de la plantilla (Figura & # x200B (Figura 1C). 1C). Con Hps, solo se observaron los productos con imprimación extendida. Con PE46, el MNV RdRp produjo sólo productos extendidos por cebadores mientras que LE19P no dirigió la síntesis de ARN (Figura & # x200B (Figura 1C). 1C). En conjunto, estos resultados muestran que MNV RdRp utilizó preferentemente su propio proscrito para dirigir la síntesis de ARN.

El GII.4 RdRp también mostró una precisión de novo iniciación de su propia proscripción in vitro (Figura & # x200B (Figura 1C). 1C). Un ARN con una sustitución en el citidilato de iniciación de Gps llamado GpsIM no pudo producir de novo ARN iniciado (Figura & # x200B (Figura 1D). 1D). El proscrito del MNV tampoco logró dirigir de novo productos de ARN iniciados, aunque se fabricaron algunos productos de extensión de cebadores. Al igual que con el MNV RdRp, el GII.4 RdRp también produjo solo pequeñas cantidades de productos de Hps, PE46 y LE19P. Similar a MNV RdRp, GII.4 RdRp tiene una fuerte preferencia por su ARN proscrito afín para la síntesis de ARN.

Elementos en Mps que contribuyen al reconocimiento por parte del MNV RdRp

Determinar la afinidad de la RdRp de MNV por su proscrito. Se sintetizó Mps para que contuviera un fluoróforo en su terminal 5 & # x02032, dando como resultado ARN fMps. fMps dirigió la síntesis de producto por el MNV RdRp de una manera indistinguible de Mps (datos no mostrados). Los ensayos de polarización de fluorescencia generaron las isotermas de unión que se ajustaron a un modelo de unión de un sitio. El MNV RdRp tenía un KD de entre 0,5 y 1 & # x003bcM para fMps (Figura & # x200B (Figura 2B 2B).

La horquilla dentro del proscrito subgenómico de MNV es necesaria para la unión de RdRp y para dirigir la síntesis de ARN. (A) Uso de ARN en este análisis. Los nombres de los ARN están en negrita. & # x00394SL1 y & # x00394SL2 tienen deleciones en la horquilla de Mps, pero las secuencias de la plantilla no se modifican. El citidilato de iniciación de la plantilla está en negrita y subrayado. (B) Resultados de polarización de fluorescencia que evalúan la afinidad de MNV RdRp por fMps. Se sintetizó químicamente ARN fMps para contener una 5 & # x02032 6-carboxifluoresceína (6-FAM) unida a Mps. Se muestra la isoterma de unión y todos los puntos de datos se evaluaron por triplicado. Los resultados son reproducibles con cuatro ensayos independientes. (C) Un ensayo de competición que evalúa las actividades inhibidoras de Mps y Mhp sobre la unión de RdRp de MNV a fMps. La concentración inhibitoria efectiva (IC50) y la pendiente Hill para los ARN competidores, Mps y Mhp, se muestran encima del gráfico. IC50 Los valores se derivaron utilizando el algoritmo desarrollado por Nikolovska-Coleska. et & # x000a0al. (61). (D) La horquilla en Mps y el Gps se pueden unir al MNV RdRp. El gráfico muestra los resultados de un ensayo de síntesis de ARN realizado con MNV RdRp en presencia de concentraciones crecientes de tres ARN competidores, Chp, Ghp y Mhp. Se obtuvieron resultados comparables en tres experimentos independientes. (mi) Eliminaciones en la horquilla dentro de Mps severamente reducidas de novo inició la síntesis de ARN. La imagen del gel era de un ensayo de síntesis de ARN con los ARN molde todos a 0,05 & # x003bcM. (F) El norovirus RdRp GII.4 puede reconocer específicamente la horquilla en la proscripción del norovirus GII.4. El gráfico muestra los resultados del ensayo de síntesis de ARN realizado con MNV RdRp en presencia de concentraciones crecientes de tres ARN competidores, Chp, Ghp y Mhp.

Buscamos determinar si Mph, la horquilla dentro de Mps, confiere unión estable a Mps. Los fMps preincubados con MNV RdRp se desafiaron con una concentración creciente de Mps o Mph (Figura & # x200B (Figura 2A). 2A). Los datos de polarización de fluorescencia resultantes se representaron frente a la concentración de ARN y los datos se ajustaron a una ecuación de Hill, obteniendo los valores de IC50 para Mps y Mhp de 2,36 y 16,2 & # x003bcM, respectivamente (Figura & # x200B (Figura2C). 2C). los KI valores calculados a partir de estos IC50 los valores fueron 0,68 & # x003bcM para Mps y 6,3 & # x003bcM para Mhp. Estos resultados sugieren que mientras que la porción de horquilla del Mps se une al RdRp de MNV, la secuencia molde contribuye a la unión estable.

A continuación, evaluamos si la horquilla en Mps es necesaria para la síntesis de ARN por el MNV RdRp. Las reacciones de síntesis de ARN programadas con MNV RdRp y Mps fueron desafiadas con concentraciones crecientes de Mph, Gph (la horquilla de la proscripción GII.4) o Chp (la horquilla de la proscripción del virus Chikungunya) (Figura & # x200B (Figura 2A) . 2A). La síntesis de ARN de Mps no se vio afectada por la adición de Chp (Figura & # x200B (Figura 2C). 2C). Sin embargo, tanto Ghp como Mhp fueron inhibidores efectivos de la síntesis de ARN. Estos resultados sugieren que el MNV RdRp reconoce preferentemente la horquilla subgenómica del norovirus, pero no pudo distinguir entre Mhp y Ghp en las condiciones utilizadas. in vitro (Figura & # x200B (Figura2D 2D).

Para determinar aún más la contribución de la horquilla en Mps al reconocimiento por el MNV RdRp, se probaron los ARN con deleciones de porciones de la horquilla Mps denominadas & # x00394SL1 y & # x00394SL2 (Figura & # x200B (Figura2A). 2A). Ambos conservaron la secuencia de inicio para la síntesis de ARN. in vitro, pero ninguno pudo dirigir de novo síntesis de ARN iniciada (Figura & # x200B (Figura 2E). 2E). La cantidad de productos de extensión de cebadores de & # x00394SL1 y & # x00394SL1 también disminuyó drásticamente en relación con los de Mps, lo que sugiere que la estructura y / o secuencia de horquilla es necesaria para el reconocimiento de MNV RdRp (Figura & # x200B (Figura 2E) ). 2E). Tanto la plantilla como la estructura de horquilla dentro de las Mps son necesarias para una síntesis de ARN eficiente.

La síntesis de ARN por GII.4 RdRp también se probó en presencia de concentraciones crecientes de ARN en horquilla competidores. Ghp inhibió la síntesis de ARN por GII.4 RdRp de proscript Gps de una manera dependiente de la concentración (Figura & # x200B (Figura 2F). 2F). En particular, el grado de inhibición fue similar a la inhibición de MNV RdRp por Mph. Curiosamente, tanto el Mhp como el Chp eran inhibidores deficientes de la síntesis de ARN por el GII.4 RdRp de Gps. Esto demuestra que GII.4 RdRp tiene una mayor especificidad por la horquilla en el proscrito GII.4 que la MNV RdRp por su horquilla subgenómica afín. Esta mayor especificidad del GII.4 RdRp para la horquilla Gps probablemente explica su disminución de novo productos de ARN iniciados de Mps (Figura & # x200B (Figura 1B 1B).

El papel de la secuencia de inicio en la síntesis de ARN viral

Tanto las réplicas virales como las ARN polimerasas dependientes de ADN reconocen los nucleótidos que abarcan el nucleótido de iniciación (36 & # x0201338). Para determinar si la secuencia monocatenaria en los proscritos contribuye a la síntesis de ARN dirigida por el norovirus RdRps, se elaboraron dos ARN quiméricos que intercambiaron las horquillas de Mps y Gps y se probaron su capacidad para funcionar. in vitro (Figura & # x200B (Figura 3A). 3A). La quimera 1 (C1) que tiene la horquilla del proscrito de MNV y la secuencia monocatenaria del proscrito de GII.4 fue deficiente para dirigir la síntesis de ARN por las RdRps de HCV, GII.4 y MNV, a pesar de que el ARN tiene la longitud y concentración correctas ( Figura & # x200B (Figura3B). 3B). Los programas de plegamiento de ARN predijeron que C1 formaría la horquilla esperada y la secuencia monocatenaria (datos no mostrados). Sin embargo, dada la pobre síntesis, la interpretación de los resultados del ARN C1 debe mantenerse al mínimo.

La secuencia de ARN monocatenario en Mps y Gps afecta la síntesis de ARN dependiente de ARN de norovirus. (A) Los esquemas de los ARN quiméricos examinados en este ensayo. El recuadro indica la estructura de horquilla, mientras que las secuencias de ARN monocatenario se muestran en su totalidad. (B) Imagen en gel de los ARN C1 y C2 sintetizados químicamente y el GpsIM. Los ARN se resolvieron en un gel de poliacrilamida al 24% modificado con urea 7,5 M. Los ARN se visualizaron mediante tinción con azul de metileno. (C) Productos de ARN por RdRps virales recombinantes de los ARN C1 y C2, así como controles. La imagen del gel contiene productos del ensayo de síntesis de ARN viral. Las longitudes de la de novo Los productos de iniciación se identifican en el lado izquierdo de la imagen del gel.Correctamente de novo Los productos iniciados y terminados de la secuencia de la plantilla MNV están etiquetados con una M. Correctamente de novo Los productos iniciados y terminados a partir de la secuencia molde de GII.4 se marcan con una G. Las cantidades de ARN sintetizado se cuantifican, se normalizan a las del proscrito de tipo salvaje y se muestran debajo de la imagen del gel. Los productos de RdRp de GII.4 y MNV están todos normalizados a las cantidades producidas por RdRp a partir de su proscrito homólogo (indicado como un 100 subrayado).

Quimera 2 (C2), que tiene la secuencia monocatenaria de MNV y la horquilla de GII.4, dirigió la GII.4 RdRp para producir el 20% de la de novo producto iniciado en comparación con Gps. Esto indica que GII.4 RdRp prefiere fuertemente su propia secuencia monocatenaria. El GII.4 RdRp también produjo más de novo ARN iniciado de C2 en comparación con Mps (20 versus 8 Figura & # x200B Figura 3C), 3C), consistente con la idea de que la horquilla afín podría promover de novo inició la síntesis de ARN.

Con el MNV RdRp, C2 dirigió solo el 17% del producto en relación con la cantidad de Mps. Dado que Mps y C2 tienen secuencias monocatenarias idénticas, el nivel reducido de síntesis de ARN demuestra que la horquilla MNV Sg es necesaria para una síntesis de ARN eficiente (Figura 2D 2D y E). C2 dirigió el MNV RdRp para producir cantidades similares de de novo ARN iniciado en comparación con Gps (Figura 17 frente a 15 & # x200B Figura 3C). 3C). Dado que C2 y Gps comparten la misma secuencia en horquilla pero difieren en sus secuencias monocatenarias, el RdRp de MNV tiene un reconocimiento más flexible de la secuencia monocatenaria que el GII.4 RdRp. Por tanto, aunque el MNV RdRp reconoce preferentemente su propio proscrito subgenómico, tiene menor especificidad tanto para la secuencia de ARN en horquilla como para la secuencia de ARN monocatenario en comparación con el GII.4 RdRp. Esta menor especificidad probablemente explica el mayor nivel de síntesis de ARN promiscuo a partir de Gps por el MNV RdRp.

Identificación de las regiones de MNV RdRp que contactan con el proscrito subgenómico

Buscamos identificar los aminoácidos específicos en el norovirus RdRp que contactan con el proscrito subgenómico. Dado que el sistema MNV ofrece una mayor flexibilidad para la manipulación genética que el norovirus humano, centramos este esfuerzo de mapeo en el MNV RdRp a pesar de su reducida especificidad por su proscrito. Los estudios de mapeo utilizaron el protocolo RCAP, que combina la reticulación reversible y la huella digital de masa de péptidos para identificar secuencias de péptidos dentro de la RdRp que pueden reticularse con el ARN viral (Figura & # x200B (Figura4A). 4A). Brevemente, los ARN y RdRp se reticularon con formaldehído, seguido de una extensa digestión del complejo con tripsina. Los ARN y péptidos asociados con el ARN se precipitaron con LiCl y las reticulaciones se invirtieron mediante calentamiento. A continuación, se utilizó MALDI-ToF / MS para identificar los péptidos asociados a ARN. Las reacciones de control que contenían el MNV RdRp tratado con formaldehído en ausencia de ARN, o el complejo RdRp-ARN que no se reticularon con formaldehído no produjeron señales por encima del fondo. Sin embargo, se identificaron 17 péptidos derivados de MNV RdRp para estar asociados con Mps y 11 con Mhp (Figura & # x200B (Figura 4B 4B y Figura complementaria S1). Dentro de cada conjunto de datos, varios péptidos tenían secuencias superpuestas debido a escisiones perdidas por tripsina, que se espera que ocurra cuando un residuo de arginina o lisina se reticula con el ARN. Ocho de los 17 péptidos RdRp de MNV identificados para asociarse con Mps, solo 8 representan regiones únicas en RdRp. Además, todos los péptidos identificados como asociados con Mhp también estuvieron presentes en reacciones realizadas con MNV RdRp y Mps. Esto es de esperar, dado que Mps contiene la horquilla que es Mph. Para visualizar las ubicaciones de estos péptidos, mapeamos estos péptidos en la estructura cristalina de MNV-1 RdRp (PDB: 3QID) (39) (Figura & # x200B (Figura 4C). 4C). Notablemente, la mayoría de los péptidos reticulados se encuentran en la cavidad central de la RdRp de MNV, donde se produce la síntesis de ARN.

Regiones del MNV RdRp que contactan con Mps y Mhp. (A) Esquema del protocolo RCAP utilizado para mapear contactos RdRp-RNA. (B) MALDI-ToF identificó péptidos de MNV RdRp que entraron en contacto con Mps o Mhp. Los péptidos que entraron en contacto con Mps y Mhp están en las columnas etiquetadas & # x02018Mps & # x02019 y & # x02018Mph & # x02019, respectivamente. Un símbolo más (+) indica que se observó el péptido. El símbolo (& # x02212) indica que no se observó el péptido. Las secuencias de los péptidos se enumeran en los códigos estándar de aminoácidos de una letra y los péptidos se alinean para mostrar solapamientos en las secuencias. (C) Regiones en MNV RdRp que entraron en contacto con Mps (rojo) o Mhp (azul) o solo con Mps (rojo). La estructura del MNV RdRp se derivó de PDB 3QID y el modelo se realizó con el software Chimera (UC San Francisco). Las ubicaciones aproximadas de los motivos RdRp A, C, E y F en el MNV RdRp están marcadas en azul.

Los péptidos asociados con Mps y Mhp se ubicaron cerca de motivos conservados en el MNV RdRp (Figura & # x200B (Figura 4C 4C paneles superior e intermedio). Los péptidos que contienen los residuos 159 & # x02013177 se superpusieron con el motivo F1 y el motivo F2 en el subdominio de los dedos del RdRp que se sabe que interactúa con el ARN y el nucleótido del sustrato (40,41). Péptidos que contienen los residuos 240 & # x02013255 superpuestos con el motivo A, que contiene aspartatos que coordinan los iones metálicos divalentes necesarios para unir NTP y catalizar la formación de enlaces fosfodiéster (40,41) Los péptidos que contienen los residuos 397 & # x02013422 estaban cerca de Motif E, que conecta los subdominios de los dedos y la palma y se ha propuesto que formen parte de la plataforma para de novo iniciación (42 & # x0201344).

Los seis péptidos RdRp de MNV asociados con Mps pero no con Mhp probablemente contactan con la secuencia monocatenaria en Mps (Figura & # x200B (Figura4C 4C inferior). Los residuos de aminoácidos 177 & # x02013183 son adyacentes al motivo F y los residuos 220 & # x02013234 y 267 & # x02013276 están cerca del Motivo A. Los residuos 385 & # x02013396 son el motivo E superpuesto, que puede representar la ubicación en el MNV RdRp que contacta tanto con la unión de la horquilla subgenómica como con la secuencia monocatenaria.

Identificación de residuos en el MNV RdRp que entran en contacto con la horquilla del promotor central

Para confirmar las identidades de los péptidos RdRp de MNV que entran en contacto con la horquilla subgenómica, utilizamos entrecruzamiento fotoactivable de alta eficacia entre análogos de 4-tio-uracilo (4SU) y aminoácidos (45). Se sintetizaron químicamente tres versiones de Mhp para que cada una contenga 4SU en los residuos 2, 15 o 24 para generar ARN denominados, respectivamente, 2-4SU, 15-4SU y 24-4SU (Figura & # x200B (Figura5A). 5A). In vitro Los ensayos de síntesis de ARN confirmaron que los tres ARN inhibían la síntesis de ARN de Mps en el mismo grado que el Mhp sin modificar (Figura complementaria S2). Después de la reticulación con MNV RdRp y la digestión con tripsina, los complejos péptido-ARN se precipitaron con LiCl. A continuación, los ARN de los complejos se digirieron completamente para liberar nucleótidos de los péptidos, dejando solo el nucleótido reticulado. A continuación, se determinaron las identidades de los péptidos reticulados mediante espectros de masas de alta resolución y disociación inducida por colisión (CID) utilizando el instrumento LTQ-Orbitrap. Kramer et & # x000a0al. han demostrado que la reticulación de proteínas y ARN sustituidos con 4SU podría sufrir la pérdida de H2S, la pérdida del doble enlace en 4SU y la pérdida de fosfatos de una o ambas posiciones 3 & # x02032 o 5 & # x02032 (45). Todas estas posibilidades estructurales se consideraron durante el análisis de los espectros de masas de Orbitrap para las reacciones de reticulación entre la proteína MNV RdRp y los ARN modificados. Se identificaron tres péptidos diferentes que tienen una o más moléculas 4SU unidas a residuos de arginina o lisina a partir de las reacciones de RdRp con los ARN modificados. La secuencia LD R ASID R QLLWTK de los residuos 409 & # x02013422 se identificó con certeza para unir 15-4SU (Figura & # x200B (Figura 5B). 5B). Los datos de CID indicaron que 15-4SU se reticuló con las cadenas laterales de R411 y R416 y dio como resultado la pérdida de su átomo de azufre como se muestra en la Figura & # x200B Figura 5C. 5C. Se identificaron dos péptidos adicionales KR LLWGSDLGTMIR (residuos 184 & # x02013197 arginina reticulada subrayados) y WDSTQQ R AIL K (residuos 249 & # x02013259, arginina reticulada y lisina subrayados) para unir 24-4SU y 2-4SU, respectivamente (Figura complementaria S3). Sin embargo, también se observaron algunas señales para ambos péptidos con 2-SU y 24-4SU, lo que sugiere que la región abultada en la horquilla y la base del ARN de la horquilla podrían entrar en contacto con RdRp en dos ubicaciones diferentes. Los tres péptidos reticulados de 4SU identificados aquí también se identificaron en el ensayo RCAP discutido anteriormente (Figura & # x200B (Figura 4). 4). Las ubicaciones de los cinco residuos reticulados se muestran en el modelo de MNV RdRp en la Figura 5D 5D.

Los residuos de MNV RdRp que contactan con 4-tiouridilato (4SU) dentro del Mhp. (A) Ubicaciones del 4-SU dentro de los ARN de Mhp sintetizados químicamente. Los nombres de los ARN con cada uno de los residuos 4-SU están en negrita. Todas las muestras se procesaron mediante un protocolo de reticulación UV que incluía una digestión exhaustiva de los ARN que deberían dejar solo el nucleótido 4-SU unido covalentemente a los péptidos. (B) Espectro de masas (MS) y espectro de disociación inducida por colisión (CID) del ión peptídico [LDR (4SU) ASIDR (4SU) QLLWTK- S2] 4+ obtenido en un instrumento Thermo LTQ-Orbitrap. (Arriba) Espectro de masas (MS) de alta resolución del ión peptídico LDR (4SU) ASIDR (4SU) QLLWTK- S2] 4+ (residuos RdRp 409 & # x02013422) de la reacción con ARN sustituido en 15-2SU. La masa monoisotópica medida (error de masa de 5 ppm) está en m / z 543,5358 (4+). (Abajo) Espectro CID de este ión peptídico en m / z 543,5. Las asignaciones de iones del fragmento CID se ilustran con líneas discontinuas en la estructura (C). (C) Estructura propuesta y fragmentos de disociación inducida por colisión (CID) (líneas discontinuas) del péptido 4SU doblemente sustituido. La pérdida más común por fragmentación es la del azúcar ribosa (m / z 133) del ión original o de sus fragmentos peptídicos del ión & # x02018b & # x02019. (D) Un resumen de las ubicaciones de los residuos en el MNV RdRp que se identificaron para entrar en contacto con los tres ARN modificados con 4-SU. Las cadenas laterales de los residuos se muestran en rojo. (mi) Alineamientos de las secuencias del norovirus RdRps que son relevantes para los residuos encontrados en el MNV RdRp que contactaban con diferentes regiones de Mhp. Todas las secuencias se muestran con su número de acceso a Genbank. Los residuos en motivos específicos conservados en RdRps virales están subrayados. Los residuos identificados para entrar en contacto con el MNV modificado con 4SU están en rojo, al igual que los residuos comparables en otros RdRps de norovirus. Cuando hay sustituciones de aminoácidos en los residuos clave, los cambios se muestran en azul.

Caracterización funcional de los sitios de contacto de la horquilla del promotor subgenómico en el MNV RdRp

Para evaluar la relevancia funcional de estos residuos que entran en contacto con el Mhp, examinamos su grado de conservación de la secuencia en los RdRps de múltiples norovirus. Los residuos R185, R255 y R416 están altamente conservados entre los norovirus, mientras que K259 y R411 se conservaron solo en norovirus murinos (Figura & # x200B (Figura5E). 5E). Razonamos que es más probable que los residuos altamente conservados sean esenciales para la síntesis de ARN, mientras que es más probable que los aminoácidos menos conservados estén involucrados en el reconocimiento específico de la especie del ARN.

Para determinar si los residuos putativos que interactúan con el ARN afectan la actividad de RdRp, se probaron proteínas recombinantes que contenían sustituciones en estos residuos para la síntesis de ARN usando Mps (Figura & # x200B (Figura 6A). 6A). Las RdRps de MNV con sustituciones de alanina en R185 y R255 altamente conservados exhiben ARN severamente reducido de novo inició la síntesis de ARN y produjo sólo una fracción del producto de cebador usando Mps como plantilla (Figuras & # x200B (Figuras 44 y & # x200B y 6B, 6B, & # x200B, C). C). Un RdRp mutante con una sustitución en el K259 menos conservado no tenía ningún defecto obvio en ninguno de los dos de novo inició la síntesis de ARN o la extensión del cebador (Figura & # x200B (Figura4 4).

Caracterización funcional de los efectos de mutaciones en el MNV RdRp para la síntesis de ARN, unión a los Mps y sus perfiles de termodesnaturalización. (A) Proteínas recombinantes purificadas utilizadas en el análisis. La imagen es una SDS-PAGE teñida con azul de Coomassie. El marcador de peso molecular (M) es de Pierce. R411AR416A indica que el RdRp recombinante contenía sustituciones de alanina tanto en R411 como en R416. (B) ARN sintetizados por el WT y RdRps del MNV mutante. La concentración de WT o RdRps mutados es 250 nM y el Mps es 50 nM en cada reacción. Los productos de la extensión de imprimación (PE) y de novo se muestran la iniciación (DN). Los productos DN tienen una longitud de 11 y 10 nt. La cantidad de ARN normalizada a la del WT se cuantificó y se muestra debajo de la imagen del gel. (C) ARN sintetizado por el WT y RdRps del MNV mutante. La concentración del WT o RdRps mutante es 1 & # x003bcM y el Mps es 50 nM en cada reacción. (D) El aumento de la concentración de Mps de la plantilla pudo restaurar la cantidad de de novoSíntesis de ARN iniciada por R411A RdRp (gráfico superior). Curiosamente, las cantidades relativas de productos de extensión de cebadores no se corrigieron para el mutante R411A. (mi) Isotermas de enlace para Mps por WT, R411 y R416 RdRps. Las constantes de disociación derivadas de las isotermas de unión son 0,5, 1,4 y 1,7 & # x003bcM para los mutantes WT MNV, R411A y R416A. Los datos se obtuvieron de ensayos de polarización fluorescente realizados con un Mps marcado con 6-FAM y RdRps recombinantes en ausencia y presencia de Mps. (F) El perfil de termodesnaturalización de WT, R411A, R416A y R411AR416A RdRps. El panel superior muestra una comparación de los perfiles de termodesnaturalización de WT MNV RdRp con mutantes R411A, R416A, R411AR416A. El R411A RdRp tiene un Tmapp 2 & # x000b0C menor que el de los mutantes WT RdRp R416A tiene un Tmapp 1 & # x000b0C más alto que el del WT RdRp R411AR416A tiene el mismo Tmapp como el de WT RdRp. (GRAMO) Los perfiles de termodesnaturación de WT RdRp sin y con Mps. (H) Perfiles de termodesnaturalización de R411A RdRp sin y con Mps. El ensayo se realizó con una relación molar 1: 2 de RdRp a ARN.

Las sustituciones en los residuos R411 y R416 tuvieron efectos más complejos sobre la síntesis de ARN. R411 se conserva solo en MNV y se encuentra cerca del motivo E. Cuando se sustituye con una lisina o una alanina, las proteínas resultantes, R411K y R411A, producen & # x0223c5 veces menos de novo producto de ARN de iniciación que el WT MNV RdRp (Figura & # x200B (Figura 6B). 6B). Curiosamente, la abundancia de productos de extensión de cebadores elaborados por R411K o R411A fue comparable o ligeramente superior a los producidos por el MNV RdRp de tipo salvaje. El mutante R416A se redujo severamente tanto para la extensión del cebador como para de novo iniciación (Figura & # x200B (Figura 6B). 6B). Cuando se incrementó la concentración de WT o RdRps mutado, R411A restauró la de novo actividad de iniciación a un nivel similar al del WT RdRp. Mutant R416A produjo más productos cuando se probó en concentraciones más altas, pero tanto la extensión del cebador como de novo la iniciación se mantuvo marcadamente reducida en comparación con la de WT RdRp. Sorprendentemente, de los dos principales de novo productos de ARN iniciados hechos por R416A, el producto terminado prematuramente por 1-nt era más abundante que el producto de longitud completa (Figura & # x200B (Figura 6C). 6C). Se ha demostrado previamente que las RdRps recombinantes que se ven afectadas en el reconocimiento del dúplex de ARN naciente molde aumentan la terminación prematura (46). La cuantificación de los ARN sintetizados por R411A, R416A o un mutante con sustituciones tanto en R411 como en R416 se muestran en la Figura 6D. 6D. Estos resultados indican que tanto el R411 como el R416 que entran en contacto con la horquilla subgenómica MNV afectan de novo inició la síntesis de ARN y confiere un reconocimiento específico de la secuencia promotora.

Los residuos R411 y R416 contribuyen a la unión de RdRp de MNV al proscrito subgenómico

Se usó un ensayo de polarización de fluorescencia para determinar la constante de disociación para la unión de fMps por R411A y R416A. El mutante R411A tenía una modesta ca. Disminución de 3 veces en la constante de disociación para Mps en comparación con WT RdRp. La unión del mutante R416A a Mps también se vio afectada modestamente a un nivel similar al de R411A (Figura & # x200B (Figura 6E). 6E). Estos resultados complementan los de los ensayos de síntesis de ARN y confirman que los residuos R411 y R416 en el MNV RdRp interactúan con Mps.

El defecto observado en la unión de ARN exhibido por R411A y R416A podría deberse a un cambio en la conformación RdRp necesaria para la unión de proscrito o un efecto sobre la afinidad por el proscrito. Para examinar si la conformación de RdRp se vio afectada, utilizamos fluorimetría de barrido diferencial (DSF) para medir el perfil de termodesnaturalización del WT y RdRps mutantes. Este ensayo mide la unión del colorante SYPRO naranja por regiones hidrófobas de proteínas que estarán cada vez más expuestas con la temperatura (47). El naranja SYPRO unido emitirá fluorescencia para informar sobre el despliegue de proteínas afectado por sustituciones de aminoácidos y / o unión de ligandos. El WT MNV RdRp tenía un aparente Tmetro (TMapp) de 43,5 & # x000b0C. R411A tenía un TMapp de ca. 2 & # x000b0C más bajo que el del WT y el mutante R416A tenía un TMapp eso fue 1 & # x000b0C más alto que el del WT. Por tanto, ambas sustituciones afectaron a la conformación de RdRp incluso antes de la unión del molde.

También se examinaron los efectos de Mps en los perfiles de termodesnaturalización del WT y RdRps mutantes. Sin embargo, no se observaron cambios en el TMapp con el WT RdRp o los mutantes. Mps redujo la fluorescencia total de las proteínas, pero se observó el mismo efecto para WT RdRp y los mutantes (Figura & # x200B (Figura6G 6G y & # x200B y H H y datos no mostrados). También hubo un pequeño cambio en fluorescencia a aproximadamente 55 & # x000b0C con R411A, cuyo significado aún se desconoce (Figura & # x200B (Figura 6H 6H).

La modificación de los residuos de RdRp de GII.4 comparables a MNV RdRp R411 aumentó moderadamente la síntesis de ARN con Mps

Como mostramos en la Figura & # x200B Figura 1B, 1B, GII.4 RdRp dirigió solo niveles bajos de de novo Síntesis de ARN a partir de Mps. Además, la alineación de la secuencia RdRp muestra que GII.4 RdRp tiene una glutamina en la posición 408 y una alanina en la posición 256, que es comparable a R411 y K259 de MNV RdRp (Figura & # x200B (Figura5E). 5E). Estas observaciones nos llevaron a determinar si GII.4 RdRp con sustituciones de Q408R, A256K o ambos podrían mejorar de novo Síntesis de ARN con el proscrito heterólogo de MNV. Los tres RdRps mutantes produjeron cantidades comparables de producto de Gps en comparación con el WT GII.4, lo que indica que no hay pérdida de especificidad por su proscrito afín (Figura & # x200B (Figura7A 7A y & # x200B yB). B). En comparación con WT MNV RdRp, los mutantes dirigieron niveles mucho más bajos de de novo iniciación del ARN de 11 nt de Mps.Sin embargo, se observó un aumento de aproximadamente 2 veces con las proteínas mutantes Q408R y Q408R / A256K en comparación con WT GII.4 RdRp (Figura & # x200B (Figura 7C). 7C). Aunque el aumento en la síntesis de ARN es modesto, los resultados son reproducibles en tres ensayos independientes. Estos resultados apoyan los datos anteriores que sugieren que el residuo R411 en MNV RdRp es importante para dirigir de novoSíntesis de ARN iniciada por el MNV RdRp del promotor del núcleo subgenómico. Estos datos también sugieren que GII.4 RdRp tiene requisitos adicionales para el reconocimiento de su proscrito subgenómico que el MNV RdRp.

El RdRp de GII.4 con una sustitución de los residuos Q408R y A256K que son comparables a R411 y K259 del RdRp de MNV tenía una síntesis de ARN ligeramente mejorada con el Mps. (A) WT y RdRps GII.4 mutante usados ​​en el ensayo. La imagen del gel contiene las proteínas purificadas separadas por SDS-PAGE y teñidas con azul de Coomassie. Las sustituciones realizadas en el RdRp de GII.4 fueron para cambiar los residuos a los presentes en el RdRp de MNV. (B) Síntesis de ARN por el WT y GII.4 RdRps mutante usando el Gps. Las tres proteínas mutantes tenían actividades comparables tanto para la iniciación de novo como para la extensión del cebador. (C) Imagen de gel de los ARN sintetizados por el WT y RdRps GII.4 mutante utilizando el Mps. La cantidad de ARN de 11 nt producido por las diversas RdRps en este ensayo se cuantifica y se enumera debajo de la imagen del gel.

Producción de virus MNV con mutaciones en el reconocimiento del promotor subgenómico

Buscamos determinar si las sustituciones en el RdRp de MNV que afectaban la iniciación del sgRNA in vitro afectaría la replicación del ARN del MNV en las células. Se diseñaron cuatro ADNc de MNV infecciosos para expresar NS7 con sustituciones de alanina en R411 (R411A), una sustitución de lisina (R411K), una sustitución de alanina en R416 (R416A) o sustituciones de alanina tanto de R411 como de R416 (R411AR416A). Cada clon infeccioso se transfectó en células BHK y se recogieron los lisados ​​celulares. El TCID50 El título en el lisado se determinó en células microgliales de ratón BV-2 que pueden ser infectadas por MNV. Los mutantes R411A y R411K tenían títulos virales 10 y 3 veces más bajos que el WT MNV (Figura & # x200B (Figura 8A). 8A). La secuenciación de los virus R411A y R411K reveló que retienen las mutaciones diseñadas y que no tienen otras mutaciones. En las transferencias de Western, los cuatro virus produjeron la proteína NS7 (Figura & # x200B (Figura 8A). 8A). Las construcciones diseñadas para expresar los virus R416A y R411AR416A no produjeron virus infecciosos (Figura & # x200B (Figura 8A). 8A). Curiosamente, las proteínas NS7 se expresaron en estas células BHK, lo que indica que el residuo R416 no puede mutarse y retener la producción de viriones (Figura & # x200B (Figura 8A, 8A, panel inferior).

Las mutaciones en el RdRp de MNV que entraron en contacto con el promotor subgenómico afectan la síntesis de ARN durante la infección por MNV. (A) Dosis infecciosa de cultivo celular para cuatro construcciones virales que tienen sustituciones en el sitio de contacto del promotor subgenómico. El gráfico de barras resume el TCID50 para las construcciones virales mutantes y WT producidas por células BHK y tituladas en células BV-2. Se utilizó ANOVA de una vía para las pruebas de significación, seguido de una prueba posterior de Dunnett para comparar todos los mutantes con el WT. ***PAG & # x0003c 0,001, **PAG & # x0003c 0.01, norte = 3. Las dos imágenes inferiores son de transferencias Western que detectan la acumulación de MNV RdRp, NS7 y el control de carga, GAPDH. Tenga en cuenta que los virus mutantes R416A y R411AR416A pueden expresar NS7, pero que no se produjo progenie viral. (B) Cinética de la formación de la progenie viral por el WT y el MNV mutante. Las células BV-2 se infectaron con una MOI de 1,0. El número de viriones producidos se determinó mediante un ensayo de infección por dilución limitada. Los dos asteriscos (**) denotan una PAG valor de & # x0003c0.01. (C) Acumulación de los ARN genómicos y subgenómicos por los mutantes de MNV R411A y R411K en células BV-2. La imagen superior es de una transferencia Northern de los ARN totales extraídos 9 h después de la infección de células BV-2 con mutantes y el WT MNV a una MOI de 3. El carril etiquetado como & # x02018MW & # x02019 contiene una escalera de peso molecular. Las transcripciones del ARN genómico y del ARNsg (los dos carriles más a la derecha) sirven como controles de masa molecular. La cuantificación de los ARNs genómicos y sgRNA proviene de tres muestras independientes de los virus mutantes WT, R411A y R411K 9 h después de la infección. La imagen inferior es del gel de agarosa desnaturalizante teñido con bromuro de etidio utilizado para la transferencia Northern. Las bandas son ARN ribosomales y el estándar de MW. Las transcripciones del gRNA y sgRNA no están presentes en abundancia para ser detectables mediante tinción con bromuro de etidio.

Caracterizamos los virus mutantes R411A y R411K para la infección de células BV-2. Las células se infectaron con 1 TCID.50 de los virus WT y mutantes y la cantidad de virus liberada determinada durante un período de 48 h (Figura & # x200B (Figura 8B). 8B). El mutante R411A produjo cantidades menores de virus en los primeros momentos, incluida una disminución de un registro 24 h después de la infección (Figura & # x200B (Figura 8B). 8B). A las 9 h después de la infección, los mutantes R411A y R411K tenían niveles reducidos de los ARNsg y genómico, siendo la reducción más severa con el mutante R411A (Figura & # x200B (Figura 8C). 8C). En conjunto, estos resultados demuestran que el residuo R411 identificado en la proteína NS7 de MNV que contacta con la horquilla del promotor subgenómico de MNV es importante para la producción de ARN de MNV en el contexto de la infección por MNV.


MATERIALES Y MÉTODOS

Expresión y purificación de RdRp de MNV recombinante y RdRp de GII.4

El ADNc que codifica la RdRp de MNV se amplificó mediante la reacción en cadena de la polimerasa (PCR) del clon de ADNc de la cepa CW1 de MNV-1 (número de acceso de GenBank: DQ285629.1) para contener un sitio de escisión de endonucleasa de restricción 5 'NdeI y un sitio BamHI en el Término 3 ′. Después de la digestión con enzimas de restricción, el cDNA se clonó en el Escherichia coli vector de expresión pET15b (Novagen) para expresar el MNV RdRp recombinante con una etiqueta de seis histidinas en el extremo N-terminal. Las mutaciones específicas del sitio en el RdRp de MNV se introdujeron utilizando el kit de mutagénesis dirigida al sitio Quick-Change (Agilent Technologies). Todas las construcciones utilizadas en este estudio se confirmaron mediante secuenciación con el kit de secuenciación de ciclos BigDye Terminator v3.1 (Applied Biosystems).

Cebador y sondas utilizados para la determinación de qPCR de copias del genoma viral

Primer. Residuos del genoma de MNV. Secuencia .
Sentido 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Antisentido 5137–5156 5′-GGCTGAATGGGGACGGCCTG
Sonda TaqMan 5962–5076 5′-ATGAGTGATGGCGCA
Fluoróforo FAM
Bebida refrescante TAMIRA
Primer. Residuos del genoma de MNV. Secuencia .
Sentido 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Antisentido 5137–5156 5′-GGCTGAATGGGGACGGCCTG
Sonda TaqMan 5962–5076 5′-ATGAGTGATGGCGCA
Fluoróforo FAM
Bebida refrescante TAMIRA
Primer. Residuos del genoma de MNV. Secuencia .
Sentido 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Antisentido 5137–5156 5′-GGCTGAATGGGGACGGCCTG
Sonda TaqMan 5962–5076 5′-ATGAGTGATGGCGCA
Fluoróforo FAM
Bebida refrescante TAMIRA
Primer. Residuos del genoma de MNV. Secuencia .
Sentido 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Antisentido 5137–5156 5′-GGCTGAATGGGGACGGCCTG
Sonda TaqMan 5962–5076 5′-ATGAGTGATGGCGCA
Fluoróforo FAM
Bebida refrescante TAMIRA

Escherichia coli Se cultivaron células de Rosetta que albergaban el plásmido pET15bMNVRdRp a 37ºC hasta que la densidad óptica a 600 nm alcanzó entre 0,6 y 0,8. Se añadió isopropil tiogalactósido (IPTG) a una concentración final de 1 mM para inducir la expresión de proteínas durante 16-18 ha 16 ° C. Las células se recolectaron por centrifugación y se resuspendieron en tampón de lisis A (TrisCl 100 mM, pH 7,9, NaCl 300 mM, glicerol al 10%, imidazol 15 mM, β-mercaptoetanol 5 mM, Triton X-100 al 0,1%, un cóctel inhibidor de proteasas [ Sigma-Aldrich]) y se sonicó en hielo tres veces durante 15 s cada una. El lisado se aclaró por centrifugación a 11 000 g durante 30 min y el sobrenadante se mezcló con resina Ni-NTA de acuerdo con las instrucciones del fabricante (Qiagen). La suspensión se empaquetó en una columna, se lavó extensamente con tampón de lisis que contenía imidazol 30 mM y se eluyó con tampón de lisis que contenía imidazol 200 mM. La proteína eluida se almacenó en tampón de almacenamiento (TrisCl 50 mM, pH 7,9, NaCl 300 mM, glicerol al 20%, Ditiotreitol (DTT) 5 mM).

El norovirus RdRp GII.4 recombinante se expresó y purificó como se describió previamente (19). Brevemente, el Top10 E. coli Las células transformadas con el plásmido pBAD GII.4RdRp se cultivaron a 37 ° C hasta una DO600 fue de alrededor de 0,6. Se añadió 1-arabinosa a una concentración final de 0,02% para inducir la expresión de la proteína. Las células se cultivaron continuamente a 37ºC durante 5 horas y luego se recogieron por centrifugación y se suspendieron en tampón A para la lisis y purificación celular utilizando la resina de afinidad de metal Talon (Clontech Laboratories) siguiendo las instrucciones del fabricante. La proteína recombinante se lavó con tampón de lisis que contenía imidazol 20 mM y se eluyó con el mismo tampón que contenía imidazol 100 mM. La proteína eluida se almacenó en tampón que contenía ácido 4- (2-hidroxietil) -1-piperazinetanosulfónico (HEPES) 50 mM, NaCl 150 mM, glicerol al 20%, DTT 5 mM. Todas las proteínas recombinantes se cuantificaron usando el ensayo de Bradford y la pureza se evaluó usando electroforesis en gel de poliacrilamida-dodecilsulfato de sodio (SDS-PAGE) teñida con azul brillante de Coomassie. Las proteínas recombinantes se almacenaron a -80 ° C para uso futuro.

Ensayo de síntesis de ARN

Los ensayos de RdRp se realizaron según lo descrito previamente por Yi et al. con modificaciones menores (25). Todos los ARN utilizados en este estudio, incluidos los que contienen 4-tiouridilato (4-SU), se sintetizaron químicamente (Thermo Scientific). Los proscritos MNV y GII.4 se diseñaron de acuerdo con las cepas MNV CW1 aislado (DQ285629) nt 5012 a 5059 y GII.4 aislado Hu / GII.4 / MD-2004/2004 / US (DQ658413) nt 5044 a 5085. Ambos ARN contienen tres nucleótidos no virales (GCG) en sus extremos 5 'para permitir la incorporación de 32 P-CTP radiomarcado durante la síntesis de ARN in vitro. Todas las reacciones de síntesis de ARN fueron de 20 μl y contenían glutamato de sodio 20 mM (pH 8,2), ditiotreitol 12,5 mM, MgCl 4 mM2, MnCl 1 mM2, Triton X-100 al 0,5% (v / v), trifosfato de guanosina 0,2 mM (GTP), trifosfato de adenosina (ATP) 0,1 mM y trifosfato de uridina (UTP), [α-32 P] 33,3 nM - trifosfato de citidina (CTP) ( MP Biomedicals), 50 nM de ARN molde y 250 nM de RdRp recombinante a menos que se indique lo contrario. La reacción se incubó a 30ºC durante 2 h, y luego se detuvo mediante la adición de ácido etilendiaminotetraacético (EDTA) (pH 8,0) hasta una concentración final de 10 mM. Los productos de ARN se cargaron directamente en un gel de poliacrilamida al 24% que contenía urea 7,5 M. Los productos de ARN radiomarcados se visualizaron y cuantificaron utilizando un software PhosphoImager (Typhoon 9210 Amersham Biosciences) y el software ImageQuant.

Análisis de huellas dactilares de péptidos de reticulación reversible (RCAP)

El ensayo RCAP se llevó a cabo como se describió anteriormente (26). Brevemente, la reacción se realizó en un volumen de 25 µl con 2 µM de MNV RdRp recombinante purificado y 4 µM de ARN sintetizado químicamente. Se añadió formaldehído a una concentración final de 0,1% (v / v) durante 10 min para reticular los complejos de ARN-proteína. Después de apagar la reticulación con 0,2 M de glicina, se añadió tripsina de grado de secuenciación (Promega) a 1:50 (p / p) junto con NH 100 mM.4HCO3 (pH 7,8) para digerir la muestra durante la noche a 37 ° C. Se utilizó LiCl 3 M para precipitar el complejo ARN-péptido seguido de dos lavados con etanol al 70%. Los enlaces cruzados de ARN-péptido se invirtieron incubando las muestras durante 1 ha 70 ° C en un tampón que contenía Tris 50 mM, pH 7,5, NaCl 200 mM y ácido trifluoroacético al 0,1%. Las muestras se purificaron y concentraron usando una columna Ziptip (Millipore) y se analizaron mediante espectrometría de masas (MS) MALDI-ToF (Bruker Autoflex III Agilent Technologies) en modo de iones positivos. Todos los picos asignados correspondieron dentro de 0,5 Da de las masas teóricas de péptidos de MNV RdRp.

Mapeo de enlaces cruzados proscript-RdRp usando ARN sustituidos con 4SU

Las reacciones de reticulación de RdRp se realizaron en microplacas de 96 pocillos de fondo transparente. Las reacciones fueron de 25 μl en volumen y contenían 2 μM de MNV RdRp purificado y 4 μM de ARN marcado con 4SU en un tampón que contenía HEPES 20 mM, pH 7,5, MgCl 4 mM.2, MnCl 1 mM2 y DTT 1 mM. Las muestras se transfirieron a microplacas sobre hielo y se realizó la reticulación ultravioleta (UV) a 365 nm durante 10 min. La digestión de tripsina y la precipitación de los complejos péptido-ARN fueron como se describió anteriormente. El sedimento se suspendió en un tampón que contenía Tris 50 mM, pH 7,5, NaCl 200 mM y se digirió con RNAsa A (1 µg) a 37ºC durante 30 min. Los péptidos y los conjugados péptido-nucleótido se purificaron usando una columna C18 y se analizaron por LC-ESI-MS / MS usando un sistema de cromatografía de nanolíquidos (AB SCIEX) interconectado a un espectrómetro de masas híbrido LTQ Orbitrap calibrado externamente equipado con una fuente de iones de nanopulverización (Thermo Scienti fi c ). Una alícuota de 4 μl del péptido digerido disuelto en 12 μl de la fase móvil A se lavó con tampón A durante 5 min a un caudal de 5 μl min -1 utilizando una columna de trampa C18 de fase reversa hecha de 15 mm × 100 μm integrafrit y empaquetada con resina Magic C18 (tamaño de poro de 200 Å, tamaño de partícula de 5 μm Bruker-Michrom). A continuación, los péptidos desalados se separaron con un gradiente de tampón B utilizando una columna C18 de fase inversa (Magic C18, 100 Å, tamaño de partícula de 5 μm, Bruker-Michrom) empaquetada en una punta de 150 mm × 75 μm, 15 μm (nuevo objetivo) y analizados en modo de iones positivos. El tampón A constaba de ácido fórmico al 0,1% en acetonitrilo: agua (3%: 97%, v / v) y el tampón B constaba de ácido fórmico al 0,1% en acetonitrilo: agua (97%: 3%, v / v). El caudal fue de 300 nl min −1 con el siguiente gradiente: 3% B de 0 a 1 min, rampa a 10% B de 1 a 9 min, rampa a 30% B de 9 a 28 min, rampa a 40% B de 28 a 31 min, rampa al 80% de B de 31 a 35 min, mantener al 90% de B de 36 a 43 min, aumentar al 3% de B de 43 a 44 min, luego volver a equilibrar la columna al 3% de B durante 14 min (58 min de tiempo de ejecución total). El espectrómetro de masas se hizo funcionar en un modo dependiente de datos automatizado, alternando entre un escaneo FT-MS en el Orbitrap y cinco escaneos de disociación inducida por colisión (CID) en la trampa de iones lineales. El Orbitrap monitoreó los iones precursores de m / z 300 hasta m / z 2000 a 15 000 de poder de resolución. Los cinco iones precursores más intensos en cada exploración se aislaron secuencialmente en la trampa lineal con un 2 m / z ancho de aislamiento y activado al 35% de energía de colisión normalizada. El ciclo se repitió continuamente a lo largo de toda la separación con la exclusión dinámica establecida en 45 s con un recuento repetido de 2. La identificación de péptidos unidos covalentemente a 4SU se realizó utilizando el software Proteome Discoverer ™ mediante la búsqueda de datos LC-MS / MS sin procesar utilizando SEQUEST ® contra la secuencia de la proteína y permitiendo modificaciones variables correspondientes a posibles estructuras 4SU unidas a la proteína.

Ensayo de polarización de fluorescencia

Todos los ensayos se realizaron en reacciones de 20 µl. Se mezcló 0,1 µM del proscrito de FL-MNV con RdRp de MNV a diversas concentraciones en el tampón de reacción que contenía Tris-HCl 10 mM pH 8,0, NaCl 30 mM, glicerol al 1% y 2-mercaptoetanol 0,5 mM. Se utilizó un contador de etiquetas múltiples Victor 3 V 1420 (Perkin Elmer) para leer los datos de polarización de fluorescencia de las placas. Las longitudes de onda de excitación y emisión se establecieron en 485 y 535 nm, respectivamente. Los datos se representaron frente a la concentración de MNV RdRp y los datos se ajustaron a una hipérbola (Y = min + (max - min) × S/(S + KD)).

Fluorimetría diferencial de barrido

Se utilizó fluorimetría diferencial de barrido (DSF) para medir los perfiles de termodesnaturación de proteínas. DSF utilizó una máquina de PCR en tiempo real Stratagene MX3005P. Cada muestra se preparó en un volumen total de 25 μl que contenía una concentración final 5 veces mayor de SYPRO Orange (Molecular Probes) en tampón que contenía glutamato de sodio 20 mM (pH 8,2), ditiotreitol 12,5 mM, MgCl 4 mM2 y MnCl 1 mM2. Se mezcló MNV RdRp recombinante o R411A mutante con Mps en una relación molar 1: 2. Todas las reacciones utilizaron una velocidad de rampa de 0,5 ° C / min y un rango de temperatura de 25 a 75 ° C. Los resultados se analizaron y se trazaron utilizando GraphPad Prism.

Construcciones de células y plásmidos

La línea celular microglial murina BV-2 se mantuvo en medio de Eagle modificado de Dulbecco (DMEM) suplementado con suero de ternero fetal (FCS) al 10%, l-glutamina 2 mM, bicarbonato de sodio al 0,075%, 100 unidades / ml de penicilina y 100 μg / ml estreptomicina (27). Las células BHK diseñadas para expresar la ARN polimerasa T7 (células BSR-T7, obtenidas de Karl-Klaus Conzelmann, Universidad Ludwig Maximilian, Munich, Alemania) se mantuvieron en DMEM que contenía FCS al 10%, penicilina (100 unidades SI / ml), estreptomicina (100 unidades SI / ml). μg / ml) y 0,5 mg / ml de G418. El clon de ADNc pT7: MNV3 'RZ, que contiene el genoma de WT MNV-1 bajo el control de un promotor de polimerasa T7 truncado, se había construido previamente (28).

Análisis de la curva de crecimiento y recuperación de virus

Las mutaciones R411A, R411K, R416A y R411 / 416AA se introdujeron en el clon infeccioso MNV-1 (pT7: MNV 3'RZ) mediante PCR mutagénica superpuesta. El virus se rescató de los clones de ADNc utilizando el sistema de genética inversa basado en la viruela aviar recombinante que expresa la ARN polimerasa T7, descrita previamente en (24). Brevemente, las células BSR-T7 se infectaron con virus de la viruela aviar recombinante que expresaba la ARN polimerasa de T7 a una MOI de aproximadamente 0,5 ufp / célula, antes de la transfección con 1 µg de cada clon de ADNc usando Lipofectamine 2000 (Invitrogen). Cuarenta y ocho horas después de la transfección (hpt), las células se congelaron y descongelaron a -80 ° C para liberar partículas de virus y se titularon mediante dilución limitante para obtener la dosis infecciosa del cultivo de tejidos al 50% (TCID50) se realizaron titulaciones en células BV-2 usando diluciones en serie de 10 veces. El TCID viral50 se determinó puntuando los signos de efecto citopático a los 5 días después de la infección mediante inspección visual. La transferencia de Western para la RdRp viral utilizó suero de conejo anti-MNV NS7 (Ab no comercial) y anti-GAPDH de ratón (Applied Biosystems) como control de carga. Los anticuerpos de cabra primarios y secundarios conjugados con HRPO que reconocen inmunoglobulinas de conejo o ratón se detectaron por quimioluminiscencia (ECL, Amersham, GE Healthcare). Se generaron reservas de paso 1 de los virus viables inoculando células BV-2 (sembradas a una densidad de 1 x 105 en placas de seis pocillos) con 700 µl de virus recuperado durante 1 h. El ARN se extrajo de las reservas utilizando el sistema GenElute ™ (Sigma-Aldrich) para la amplificación por RT-PCR y la verificación de las mutaciones mediante secuenciación del ADN.

Predicción de estructura secundaria de ARN y generación de modelos de proteínas

Todas las estructuras secundarias de ARN en este estudio se predijeron utilizando el programa Mfold (29). Los gráficos moleculares y los análisis de MNV RdRp (PDB: 3QID) se realizaron con el paquete Chimera de la Universidad de California en San Francisco (www.cgl.ucsf.edu/chimera).


Contenido

Para que tenga lugar la transcripción, la enzima que sintetiza el ARN, conocida como ARN polimerasa, debe unirse al ADN cerca de un gen. Los promotores contienen secuencias de ADN específicas, como elementos de respuesta, que proporcionan un sitio de unión inicial seguro para la ARN polimerasa y para proteínas llamadas factores de transcripción que reclutan ARN polimerasa. Estos factores de transcripción tienen secuencias activadoras o represoras específicas de nucleótidos correspondientes que se unen a promotores específicos y regulan la expresión génica.

En bacterias, el promotor es reconocido por la ARN polimerasa y un factor sigma asociado, que a su vez son llevados al ADN del promotor por la unión de una proteína activadora a su propio sitio de unión de ADN cercano.En eucariotas El proceso es más complicado y son necesarios al menos siete factores diferentes para la unión de una ARN polimerasa II al promotor.

Los promotores representan elementos críticos que pueden trabajar en concierto con otras regiones reguladoras (potenciadores, silenciadores, elementos de frontera / aislantes) para dirigir el nivel de transcripción de un gen dado. Se induce un promotor en respuesta a cambios en la abundancia o conformación de proteínas reguladoras en una célula, que permiten la activación de factores de transcripción para reclutar ARN polimerasa. [2] [3]

Como los promotores suelen estar inmediatamente adyacentes al gen en cuestión, las posiciones en el promotor se designan en relación con el sitio de inicio de la transcripción, donde comienza la transcripción del ADN para un gen en particular (es decir, las posiciones corriente arriba son números negativos que se cuentan desde -1, por ejemplo -100 es una posición de 100 pares de bases en sentido ascendente).

En el núcleo celular, parece que los promotores se distribuyen preferentemente en el borde de los territorios cromosómicos, probablemente para la coexpresión de genes en diferentes cromosomas. [4] Además, en los seres humanos, los promotores muestran ciertos rasgos estructurales característicos de cada cromosoma. [4]

Eucariota Editar

  • Promotor central: la porción mínima del promotor necesaria para iniciar correctamente la transcripción [5]
    • Incluye el sitio de inicio de la transcripción (TSS) y elementos directamente aguas arriba
    • Un sitio de unión para la ARN polimerasa
        : transcribe genes que codifican ARN ribosómico 18S, 5.8S y 28S: transcribe genes que codifican ARN mensajero y ciertos ARN nucleares pequeños y microARN: transcribe genes que codifican ARN de transferencia, ARN ribosómico 5s y otros ARN pequeños
      • Aproximadamente 250 pares de bases aguas arriba del sitio de inicio
      • Sitios de unión de factores de transcripción específicos
      • Cualquier cosa más arriba (pero no un potenciador u otra región reguladora cuya influencia sea independiente de la posición / orientación)
      • Sitios de unión de factores de transcripción específicos

      Edición bacteriana

      En las bacterias, el promotor contiene dos elementos de secuencia corta de aproximadamente 10 (Pribnow Box) y 35 nucleótidos. río arriba desde el sitio de inicio de la transcripción.

      • La secuencia en -10 (el elemento -10) tiene la secuencia consenso TATAAT.
      • La secuencia en -35 (el elemento -35) tiene la secuencia consenso TTGACA.
      • Las secuencias consenso anteriores, aunque se conservan en promedio, no se encuentran intactas en la mayoría de los promotores. En promedio, solo de 3 a 4 de los 6 pares de bases en cada secuencia consenso se encuentran en cualquier promotor dado. Hasta la fecha se han identificado pocos promotores naturales que posean secuencias consenso intactas en los promotores artificiales -10 y -35 con conservación completa de los elementos -10 y -35 que se transcriban a frecuencias más bajas que aquellos con algunos desajustes con el consenso.
      • El espaciado óptimo entre las secuencias -35 y -10 es de 17 pb.
      • Algunos promotores contienen uno o más subsitios del elemento promotor aguas arriba (elemento UP) [7] (secuencia de consenso 5'-AAAAAARNR-3 'cuando se centra en la región -42 secuencia de consenso 5'-AWWWWWTTTT-3' cuando se centra en la región -52 W = A o TR = A o GN = cualquier base). [8]

      Las secuencias promotoras anteriores son reconocidas solo por la holoenzima de ARN polimerasa que contiene sigma-70. Las holoenzimas de ARN polimerasa que contienen otros factores sigma reconocen diferentes secuencias promotoras centrales.

      Probabilidad de aparición de cada nucleótido Editar

      Eucariota Editar

      Los promotores eucariotas son diversos y pueden ser difíciles de caracterizar, sin embargo, estudios recientes muestran que se dividen en más de 10 clases. [9]

      Los promotores de genes se encuentran típicamente aguas arriba del gen y pueden tener elementos reguladores a varias kilobases de distancia del sitio de inicio de la transcripción (potenciadores). En eucariotas, el complejo transcripcional puede hacer que el ADN se doble sobre sí mismo, lo que permite la colocación de secuencias reguladoras lejos del sitio real de transcripción. Los promotores eucarióticos dependientes de la ARN polimerasa II pueden contener un elemento TATA (secuencia consenso TATAAA), que es reconocido por el factor de transcripción general, proteína de unión a TATA (TBP) y un elemento de reconocimiento B (BRE), que es reconocido por la factor de transcripción TFIIB. [5] [10] [11] El elemento TATA y BRE típicamente se encuentran cerca del sitio de inicio de la transcripción (típicamente dentro de 30 a 40 pares de bases).

      Las secuencias reguladoras del promotor eucariota típicamente se unen a proteínas llamadas factores de transcripción que están involucrados en la formación del complejo transcripcional. Un ejemplo es la caja E (secuencia CACGTG), que une factores de transcripción en la familia básica hélice-bucle-hélice (bHLH) (por ejemplo, BMAL1-Clock, cMyc). [12] Algunos promotores que son el objetivo de múltiples factores de transcripción pueden alcanzar un estado hiperactivo, lo que lleva a una mayor actividad transcripcional. [13]

      Los promotores interactúan con potenciadores, factores de transcripción, complejo mediador y bucles de ADN en la transcripción de mamíferos Editar

      La expresión regulada positivamente de genes en mamíferos se inicia cuando se transmiten señales a los promotores asociados con los genes. Las secuencias de ADN promotor pueden incluir diferentes elementos tales como islas CpG (presentes en aproximadamente el 70% de los promotores), una caja TATA (presente en aproximadamente el 24% de los promotores), iniciador (Inr) (presente en aproximadamente el 49% de los promotores), corriente arriba y elementos de reconocimiento de TFIIB cadena abajo (BREu y BREd) (presentes en aproximadamente el 22% de los promotores), y elemento promotor del núcleo cadena abajo (DPE) (presente en aproximadamente el 12% de los promotores). [14] La presencia de múltiples sitios CpG metilados en islas CpG de promotores provoca un silenciamiento estable de genes. [15] Sin embargo, los experimentos de Weingarten-Gabbay et al. [16] mostró que la presencia o ausencia de los otros elementos tiene efectos relativamente pequeños sobre la expresión génica. Dos secuencias, la caja TATA e Inr, provocaron aumentos pequeños pero significativos en la expresión (aumentos del 45% y 28%, respectivamente). Los elementos BREu y BREd disminuyeron significativamente la expresión en un 35% y 20%, respectivamente, y el elemento DPE no tuvo ningún efecto detectado sobre la expresión. [dieciséis]

      Los módulos reguladores cis que están localizados en regiones de ADN distantes de los promotores de genes pueden tener efectos muy importantes sobre la expresión génica, y algunos genes experimentan una expresión aumentada hasta 100 veces debido a dicho módulo regulador cis. [17] Estos módulos cis-reguladores incluyen potenciadores, silenciadores, aislantes y elementos de anclaje. [18] Entre esta constelación de elementos, los potenciadores y sus factores de transcripción asociados tienen un papel principal en la regulación de la expresión génica. [19]

      Los potenciadores son regiones del genoma que son los principales elementos reguladores de genes. Los potenciadores controlan los programas de expresión génica específicos del tipo de célula, la mayoría de las veces recorriendo largas distancias para acercarse físicamente a los promotores de sus genes diana. [20] En un estudio de neuronas corticales cerebrales, se encontraron 24,937 bucles que traen potenciadores a los promotores. [17] Múltiples potenciadores, cada uno a menudo a decenas o cientos de miles de nucleótidos distantes de sus genes diana, se enlazan con sus promotores de genes diana y se coordinan entre sí para controlar la expresión de su gen diana común. [20]

      La ilustración esquemática de esta sección muestra un potenciador dando vueltas para acercarse físicamente al promotor de un gen diana. El bucle se estabiliza mediante un dímero de una proteína conectora (por ejemplo, dímero de CTCF o YY1), con un miembro del dímero anclado a su motivo de unión en el potenciador y el otro miembro anclado a su motivo de unión en el promotor (representado por el zigzags rojos en la ilustración). [21] Varios factores de transcripción específicos de la función celular (hay alrededor de 1600 factores de transcripción en una célula humana [22]) generalmente se unen a motivos específicos en un potenciador [23] y una pequeña combinación de estos factores de transcripción unidos al potenciador, cuando se acercan a un promotor mediante un bucle de ADN, rigen el nivel de transcripción del gen diana. El mediador (coactivador) (un complejo que generalmente consta de aproximadamente 26 proteínas en una estructura que interactúa) comunica las señales reguladoras de los factores de transcripción unidos al ADN potenciador directamente a la enzima ARN polimerasa II (pol II) unida al promotor. [24]

      Los potenciadores, cuando están activos, generalmente se transcriben a partir de ambas cadenas de ADN con las ARN polimerasas que actúan en dos direcciones diferentes, produciendo dos eRNA como se ilustra en la Figura. [25] Un potenciador inactivo puede estar unido por un factor de transcripción inactivo. La fosforilación del factor de transcripción puede activarlo y ese factor de transcripción activado puede activar el potenciador al que está unido (ver la pequeña estrella roja que representa la fosforilación del factor de transcripción unido al potenciador en la ilustración). [26] Un potenciador activado comienza la transcripción de su ARN antes de activar un promotor para iniciar la transcripción del ARN mensajero de su gen objetivo. [27]

      Bidireccional (mamífero) Editar

      Los promotores bidireccionales son regiones intergénicas cortas (& lt1 kpb) de ADN entre los extremos 5 'de los genes en un par de genes bidireccionales. [28] Un "par de genes bidireccionales" se refiere a dos genes adyacentes codificados en cadenas opuestas, con sus extremos 5 'orientados uno hacia el otro. [29] Los dos genes a menudo están relacionados funcionalmente, y la modificación de su región promotora compartida les permite co-regularse y, por lo tanto, coexpresarse. [30] Los promotores bidireccionales son una característica común de los genomas de mamíferos. [31] Aproximadamente el 11% de los genes humanos están emparejados bidireccionalmente. [28]

      Los genes emparejados bidireccionalmente en la base de datos de Gene Ontology compartieron al menos una categoría funcional asignada a la base de datos con sus socios el 47% del tiempo. [32] El análisis de microarrays ha demostrado que los genes emparejados bidireccionalmente se coexpresan en mayor grado que los genes aleatorios o los genes unidireccionales vecinos. [28] Aunque la coexpresión no indica necesariamente la co-regulación, se ha demostrado que la metilación de las regiones promotoras bidireccionales regula negativamente ambos genes y la desmetilación regula positivamente ambos genes. [33] Sin embargo, existen excepciones. En algunos casos (alrededor del 11%), solo se expresa un gen de un par bidireccional. [28] En estos casos, el promotor está implicado en la supresión del gen no expresado. El mecanismo detrás de esto podría ser la competencia por las mismas polimerasas o la modificación de la cromatina. La transcripción divergente podría cambiar los nucleosomas para regular al alza la transcripción de un gen, o eliminar los factores de transcripción unidos para regular a la baja la transcripción de un gen. [34]

      Algunas clases funcionales de genes tienen más probabilidades de estar emparejadas bidireccionalmente que otras. Los genes implicados en la reparación del ADN tienen cinco veces más probabilidades de estar regulados por promotores bidireccionales que por promotores unidireccionales. Las proteínas chaperonas son tres veces más probables y los genes mitocondriales tienen más del doble de probabilidad. Muchos genes básicos de limpieza y metabólicos celulares están regulados por promotores bidireccionales. [28] La sobrerrepresentación de genes de reparación de ADN emparejados bidireccionalmente asocia estos promotores con el cáncer. El cuarenta y cinco por ciento de los oncogenes somáticos humanos parecen estar regulados por promotores bidireccionales, significativamente más que los genes que no causan cáncer. La hipermetilación de los promotores entre los pares de genes WNT9A / CD558500, CTDSPL / BC040563 y KCNK15 / BF195580 se ha asociado con tumores. [33]

      Se han observado ciertas características de secuencia en promotores bidireccionales, incluida la falta de cajas TATA, una abundancia de islas CpG y una simetría alrededor del punto medio de Cs y As dominantes en un lado y Gs y Ts en el otro. Recientemente se demostró que un motivo con la secuencia consenso de TCTCGCGAGA, también llamado elemento CGCG, impulsa la transcripción bidireccional impulsada por PolII en islas CpG. [35] Las cajas CCAAT son comunes, como lo son en muchos promotores que carecen de cajas TATA. Además, los motivos NRF-1, GABPA, YY1 y ACTACAnnTCCC están representados en los promotores bidireccionales a tasas significativamente más altas que en los promotores unidireccionales. La ausencia de cajas TATA en promotores bidireccionales sugiere que las cajas TATA juegan un papel en la determinación de la direccionalidad de los promotores, pero los contraejemplos de promotores bidireccionales poseen cajas TATA y promotores unidireccionales sin ellos indica que no pueden ser el único factor. [36]

      Aunque el término "promotor bidireccional" se refiere específicamente a regiones promotoras de genes que codifican ARNm, los ensayos de luciferasa han demostrado que más de la mitad de los genes humanos no tienen un fuerte sesgo direccional. La investigación sugiere que los ARN no codificantes se asocian con frecuencia con las regiones promotoras de los genes que codifican el ARNm. Se ha planteado la hipótesis de que el reclutamiento y la iniciación de la ARN polimerasa II generalmente comienza bidireccionalmente, pero la transcripción divergente se detiene en un punto de control más tarde durante el alargamiento. Los posibles mecanismos detrás de esta regulación incluyen secuencias en la región promotora, modificación de la cromatina y la orientación espacial del ADN. [34]

      Un promotor subgenómico es un promotor añadido a un virus para un gen heterólogo específico, lo que da como resultado la formación de ARNm para ese gen solo. Muchos virus de ARN de sentido positivo producen estos ARNm subgenómicos (ARNsg) como una de las técnicas de infección comunes utilizadas por estos virus y generalmente transcriben genes virales tardíos. Los promotores subgenómicos varían de 24 nucleótidos (virus Sindbis) a más de 100 nucleótidos (virus de la vena amarilla necrótica de la remolacha) y generalmente se encuentran aguas arriba del inicio de la transcripción. [37]

      Se ha desarrollado una amplia variedad de algoritmos para facilitar la detección de promotores en la secuencia genómica, y la predicción de promotores es un elemento común de muchos métodos de predicción de genes. Una región promotora se localiza antes de las secuencias de consenso -35 y -10. Cuanto más cerca esté la región promotora de las secuencias consenso, más a menudo tendrá lugar la transcripción de ese gen. No hay un patrón establecido para las regiones promotoras como lo hay para las secuencias consenso.

      Los cambios en las secuencias promotoras son críticos en la evolución, como lo indica el número relativamente estable de genes en muchos linajes. Por ejemplo, la mayoría de los vertebrados tienen aproximadamente el mismo número de genes codificadores de proteínas (alrededor de 20.000) que a menudo están muy conservados en secuencia, por lo que gran parte del cambio evolutivo debe provenir de cambios en la expresión génica. [4] [9]

      Origen de novo de los promotores Editar

      Dadas las secuencias cortas de la mayoría de los elementos promotores, los promotores pueden evolucionar rápidamente a partir de secuencias aleatorias. Por ejemplo, en E. coli,

      El 60% de las secuencias aleatorias pueden desarrollar niveles de expresión comparables a los del promotor lac de tipo salvaje con solo una mutación, y eso

      El 10% de las secuencias aleatorias pueden servir como promotores activos incluso sin evolución. [39]

      Otros estudios recientes sugieren que los promotores de genes pueden ser la causa principal de diabetes. [40] Los promotores de genes asociados con la diabetes mediante estudios de asociación de todo el genoma (GWAS) muestran patrones de ADN específicos para cada fenotipo. [40] Esta observación indica que los promotores de estos genes utilizan factores de transcripción específicos para cada fenotipo de diabetes. [40]

      El inicio de la transcripción es un proceso secuencial de varios pasos que involucra varios mecanismos: ubicación del promotor, unión inicial reversible de la ARN polimerasa, cambios conformacionales en la ARN polimerasa, cambios conformacionales en el ADN, unión del nucleósido trifosfato (NTP) al promotor funcional de la ARN polimerasa. iniciación compleja, no productiva y productiva de la síntesis de ARN. [41]

      El proceso de unión del promotor es crucial para comprender el proceso de expresión génica.

      Ubicación Editar

      Aunque la holoenzima de la ARN polimerasa muestra una alta afinidad por sitios inespecíficos del ADN, esta característica no nos permite aclarar el proceso de localización del promotor. [42] Este proceso de localización del promotor se ha atribuido a la estructura de la holoenzima al ADN y sigma 4 a los complejos de ADN. [43]

      La mayoría de las enfermedades son de causa heterogénea, lo que significa que una "enfermedad" suele ser muchas enfermedades diferentes a nivel molecular, aunque los síntomas que se presentan y la respuesta al tratamiento pueden ser idénticos. La forma en que las enfermedades de diferente origen molecular responden a los tratamientos se aborda parcialmente en la disciplina de la farmacogenómica.

      No se enumeran aquí los muchos tipos de cánceres que implican una regulación transcripcional aberrante debido a la creación de genes quiméricos a través de la translocación cromosómica patológica. Es importante destacar que la intervención en el número o la estructura de las proteínas unidas al promotor es una clave para tratar una enfermedad sin afectar la expresión de genes no relacionados que comparten elementos con el gen diana. [44] Algunos genes cuyo cambio no es deseable pueden influir en el potencial de una célula para volverse cancerosa. [45]

      En los seres humanos, aproximadamente el 70% de los promotores ubicados cerca del sitio de inicio de la transcripción de un gen (promotores proximales) contienen una isla CpG. [46] [47] Las islas CpG tienen generalmente de 200 a 2000 pares de bases de largo, tienen un contenido de pares de bases C: G & gt50% y tienen regiones de ADN donde un nucleótido de citosina es seguido por un nucleótido de guanina y esto ocurre con frecuencia en el secuencia de bases a lo largo de su dirección 5 '→ 3'.

      Los promotores distales también contienen con frecuencia islas CpG, como el promotor del gen de reparación del ADN. ERCC1, donde el promotor que contiene la isla CpG se encuentra a unos 5.400 nucleótidos corriente arriba de la región codificante del ERCC1 gene. [48] ​​Las islas CpG también se encuentran con frecuencia en los promotores de ARN funcionales no codificantes, como los microARN.

      En los seres humanos, la metilación del ADN se produce en la posición 5 'del anillo de pirimidina de los residuos de citosina dentro de los sitios CpG para formar 5-metilcitosinas. La presencia de múltiples sitios CpG metilados en islas CpG de promotores provoca un silenciamiento estable de genes. [15] El silenciamiento de un gen puede ser iniciado por otros mecanismos, pero esto a menudo es seguido por la metilación de los sitios CpG en la isla CpG del promotor para causar el silenciamiento estable del gen. [15]

      Generalmente, en la progresión al cáncer, se silencian o activan cientos de genes. Aunque el silenciamiento de algunos genes en los cánceres ocurre por mutación, una gran proporción del silenciamiento de genes cancerígenos es el resultado de una alteración de la metilación del ADN (ver Metilación del ADN en el cáncer). La metilación del ADN que causa el silenciamiento en el cáncer ocurre típicamente en múltiples sitios CpG en las islas CpG que están presentes en los promotores de genes que codifican proteínas.

      Las expresiones alteradas de microARN también silencian o activan muchos genes en progresión al cáncer (ver microARN en cáncer). La expresión alterada de microARN ocurre a través de hiper / hipometilación de sitios CpG en islas CpG en promotores que controlan la transcripción de microARN.

      El silenciamiento de los genes de reparación del ADN mediante la metilación de las islas CpG en sus promotores parece ser especialmente importante en la progresión al cáncer (ver metilación de los genes de reparación del ADN en el cáncer).

      El uso del término secuencia canónica para referirse a un promotor es a menudo problemático y puede dar lugar a malentendidos acerca de las secuencias promotoras. Canónico implica perfecto, en cierto sentido.

      En el caso de un sitio de unión a un factor de transcripción, puede haber una única secuencia que se una a la proteína con más fuerza en condiciones celulares específicas. Esto podría llamarse canónico.

      Sin embargo, la selección natural puede favorecer la unión menos energética como una forma de regular la producción transcripcional. En este caso, podemos llamar a la secuencia más común en una población la secuencia de tipo salvaje. Puede que ni siquiera sea la secuencia más ventajosa de tener en las condiciones imperantes.

      La evidencia reciente también indica que varios genes (incluido el protooncogén c-myc) tienen motivos G-quadruplex como posibles señales reguladoras.

      Algunos casos de muchas enfermedades genéticas están asociados con variaciones en los promotores o factores de transcripción.

      Algunos promotores se denominan constitutivos porque están activos en todas las circunstancias en la célula, mientras que otros están regulados y se vuelven activos en la célula solo en respuesta a estímulos específicos.


      ¿Qué es un promotor subgenómico? - biología

      Esta es una continuación de la aplicación Ser. No. 08 / 197.222, presentada el 16 de febrero de 1994, ahora abandonada, que es la continuación de la solicitud Ser. No. 08 / 069,457, presentada el 1 de junio de 1993, ahora abandonada, que es una continuación de la solicitud Ser. No. 07 / 683.516, presentada el 8 de abril de 1991, ahora abandonada, que es una continuación de la solicitud Ser. No. 07 / 168.691, presentada el 16 de marzo de 1988, ahora abandonada, y una continuación en parte de la Ser. No. 07 / 368,939, presentada el 19 de junio de 1989, ahora abandonada, que es la continuación de la Ser. No. 06 / 709.181, presentada el 7 de marzo de 1985, ahora abandonada.

      1. Una molécula de ADN recombinante construida artificialmente que comprende la secuencia de nucleótidos de un promotor del núcleo subgenómico del virus de ARN vegetal de cadena (+) seleccionado del grupo que consiste en tobamovirus, tobravirus, bromovirus, cucumovirus y virus del mosaico de alfalfa, en el que dicho virus de ARN de cadena (+) comprende una secuencia consenso seleccionada del grupo que consiste en AUCUAUGUU y secuencias que tienen un solo emparejamiento erróneo con el mismo, y en el que dicho virus de ARN de cadena (+) comprende además un dominio de activación correspondiente a la secuencia de nucleótidos de un sitio BstXI a un sitio BglII del ADNc correspondiente al ARN de la FIG. 2, y en el que dicho dominio de activación está situado en 5 'con respecto a dicha secuencia promotora del núcleo subgenómico.

      2. La molécula de ADN recombinante de la reivindicación 1, en la que dicho promotor del núcleo subgenómico es el promotor subgenómico del virus del mosaico del bromo.

      3. Una molécula de ADN recombinante que comprende el promotor subgenómico de la reivindicación 2 y que además comprende un gen expresable en plantas bajo el control regulador de dicho promotor subgenómico.

      4. La molécula de ADN recombinante de la reivindicación 2, en la que dicho promotor subgenómico comprende la secuencia del promotor central desde un sitio BglII hasta un sitio SalII del ADNc correspondiente al ARN de la FIG. 2, y comprende además la secuencia de activación desde un sitio BstXI a un sitio BglII del cDNA correspondiente al RNA de la FIG. 2, en el que dicho dominio de activación está ubicado a no más de 95 nucleótidos cadena arriba de un sitio de inicio de la transcripción subgenómica.

      5. La molécula de ADN recombinante de la reivindicación 2, en la que dicho promotor subgenómico comprende la secuencia del promotor central desde un sitio BglII hasta un sitio SalI del ADNc correspondiente al ARN de la FIG. 2, y comprende además la secuencia de activación de un sitio AvaI a un sitio BglII del cDNA correspondiente al RNA de la FIG. 2, en el que dicho dominio de activación está ubicado a no más de 95 nucleótidos cadena arriba de un sitio de inicio de la transcripción subgenómica.

      6. La molécula de ADN recombinante de la reivindicación 2, que comprende además una segunda copia de dicho promotor de núcleo subgenómico y una segunda copia de dicho dominio de activación, en la que dicha segunda copia de dicho dominio de activación se coloca en 5 'de dicha segunda copia de un promotor de núcleo subgenómico para formar un segundo promotor subgenómico y en el que dicho segundo promotor subgenómico se coloca dentro de dicha molécula de ADN recombinante construida artificialmente para permitir el funcionamiento de dicho segundo promotor subgenómico dentro de una copia de ARN de dicha molécula de ADN recombinante.

      7. Una molécula de ADN recombinante construida artificialmente que comprende un promotor subgenómico, en la que dicho promotor subgenómico comprende una secuencia de nucleótidos del virus del mosaico de brome desde un sitio BstXI a un sitio SalI del ADNc correspondiente al ARN de la FIG. 2, y copias duplicadas de un dominio de activación del virus del mosaico de brome, en el que dicha secuencia duplicada es de un sitio AvaI a un sitio BgIII del cDNA correspondiente al RNA de la FIG. 2, en el que dicha secuencia de dominio de activación duplicada está ubicada aproximadamente 220 nucleótidos cadena arriba de un sitio de inicio de transcripción subgenómico, comprendiendo además dicho promotor subgenómico una secuencia de consenso seleccionada del grupo que consiste en AUCUAUGUU y secuencias que tienen un solo emparejamiento erróneo con el mismo, y dicha molécula de ADN recombinante además que comprende un gen expresable en plantas bajo el control regulador de dicho promotor subgenómico.

      El campo de esta invención es el área de la biología molecular, y se relaciona en particular con el campo de los virus de ARN de cadena (+). Las enseñanzas de la presente invención permitirán el uso de una secuencia de control viral, denominada promotor subgenómico, para la expresión génica dirigida en la célula huésped apropiada. Específicamente, se ejemplifica el promotor subgenómico del ARN3 del virus del mosaico del bromo para amplificar la expresión de un gen estructural en tejido vegetal.

      ANTECEDENTES DE LA INVENCIÓN

      Los virus de ARN monocatenario que son capaces de replicarse en el citoplasma de las células huésped son de naturaleza generalizada. Los virus monocatenarios con moléculas de ARN genómico con sentido de mensaje se denominan virus de ARN de cadena (+) o cadena positiva. Entre los virus de ARN de cadena (+) conocidos existen variedades específicas de bacterias, específicas de animales y específicas de plantas. Existe mucha diversidad en la morfología de las partículas virales, las proteínas de la cubierta, la organización genética y el tamaño del genoma. Los virus de ARN de cadena (+) incluyen, entre otros, bacteriófagos Q-beta, poliovirus y alfavirus (incluido el virus Sindbis) de células animales, y los bromovirus (incluido el virus del mosaico del bromo) y los comovirus (incluido el virus del mosaico del pepino). de las plantas.

      Se ha publicado una revisión general de la replicación del virus de la cadena (+) (E. Strauss y J. Strauss (1983) Curr. Top. Microbiol. Immunol. 105: 1). A continuación, se muestra un breve resumen de los pasos. Pueden ser necesarias proteínas determinadas por virus junto con el ARN genómico (S) para que se produzca la infección, o pueden sintetizarse todas las proteínas virales necesarias para iniciar la replicación del virus utilizando el ARN genómico viral entrante como mensaje. No existe un intermedio de ADN en la replicación del ácido nucleico de estos virus. La replicación de la información genética de un virus de ARN de cadena (+) requiere la capacidad sintética de ARN dependiente de ARN de las células infectadas con dichos virus. La hebra genómica (+) entrante sirve como plantilla para la síntesis de moléculas de hebra (-), y luego las hebras (+) de la progenie se sintetizan utilizando las hebras (-) como plantillas. En el último paso hay una amplificación de las cadenas (+) sobre las moléculas de la cadena (-). La (s) molécula (s) de ARN viral de la cadena (+) se traducen generalmente, al menos en parte, para producir replicasa específica del virus. Las hebras (-) sirven como plantillas para la síntesis posterior de un gran número de hebras (+) que pueden portar genes estructurales y que están destinadas a encapsidarse por la proteína de la cubierta. Las proteínas estructurales se traducen a partir de ARN genómico o de ARN subgenómico, según el virus. En el caso de los virus de cadena (+) con genomas de ARN multicomponente, las moléculas de ARN pueden encapsidarse en partículas virales separadas, en cuyo caso la célula huésped debe infectarse simultáneamente con cada componente para producir una infección productiva.

      Los virus de ARN de cadena (+) de plantas se han clasificado en dos supergrupos (R. Goldbach (1986) Ann. Rev. Phytopathol. 24: 289). El supergrupo similar a picornavirus incluye comovirus, nepovirus y polivirus, mientras que el segundo supergrupo incluye aquellos virus que se asemejan al virus alfavirus animal Sindbis: los tobamovirus, tobravirus, bromovirus, cucumovirus y virus del mosaico de la alfalfa. Aunque los virus de ARN de cadena (+) de plantas y animales son diversos con respecto al rango de hospedadores, las estructuras del genoma y de las partículas, y los mecanismos exactos de replicación viral, existen algunas homologías de secuencias de aminoácidos y ácidos nucleicos (revisado en R. Goldbach (1987 ) Microbiol. Sci. 4: 197). Se han descrito homologías de secuencia de aminoácidos para poliovirus, fiebre aftosa y virus del mosaico del caupí (H. Franssen et al. (1984) EMBO J.3: 855), y para proteínas no estructurales codificadas por el virus del mosaico del bromo, mosaico de alfalfa. virus, virus del mosaico del tabaco y virus Sindbis (J. Haseloff y col. (1984) Proc. Nat. Acad. Sci. USA 81: 4358 P. Ahlquist y col. (1985) J. Virol. 53: 536). Se cree que las regiones homólogas dentro de las proteínas no estructurales reflejan similitudes mecánicas en la replicación del ácido nucleico viral y posiblemente relaciones evolutivas.

      Los alfavirus y los virus de plantas similares a Sindbis también comparten una estrategia común para la síntesis de la proteína de la cubierta (y en algunos casos para la síntesis de proteínas adicionales). Esa estrategia es el uso de un promotor interno para dirigir la síntesis de ha ( +) molécula de ARN de cadena, denominada ARN subgenómico, que utiliza la cadena (-) como molde. El ARN subgenómico comprende un subconjunto de secuencias que se encuentran en el ARN "genómico" (de longitud completa) correspondiente, y puede encapsularse en partículas virales. En el caso del virus del mosaico de brome (BMV), las moléculas de ARN de cadena (+) superan en número a la plantilla de cadena (-) de longitud completa en aproximadamente 100 a 1, y los ARN subgenómico y genómico de longitud completa se producen en cantidades aproximadamente equimolares (francés y Ahlquist (1987) J. Virol. 61: 1457. sintetizar cantidades de miligramos de c proteína de avena (L. Lane (1981) en Handbook of Plant Virus Infections and Comparative Diagnosis, E. Kurstak, Ed., Elsevier / North-Holland, Amsterdam, págs. 333-376).

      Los bromovirus son un grupo de virus vegetales de cadena (+) con genomas tripartitos. En este grupo se incluyen el virus del mosaico del bromo, el virus del mosaico clorótico del caupí (CCMV) y el virus del mosaico del frijol ancho (BBMV). CCMV y BBMV infectan las dicotiledóneas caupí y habas respectivamente, y el rango de hospedadores de BMV son las gramíneas, incluidos los cereales (L. C. Lane, (1981) en The Handbook of Plant Virus Infections and Comparative Diagnosis, Capítulo 12, Elsevier, Amsterdam). La cebada es un huésped experimental común para BMV, que ha sido bien caracterizado.

      La cepa BMV M1 (Madison 1) (P. Ahlquist y col. (1984) Proc. Nat. Acad. Sci. USA 81: 7066) es el sistema experimental elegido para ejemplificar la presente invención. El genoma del BMV está compuesto por tres moléculas de ARN de secuencia única y conocida: ARN1 tiene 3234 bases de longitud, ARN2 tiene 2865 bases de longitud (P. Ahlquist et al. (1984) J. Mol. Biol. 172: 369), y El ARN3 tiene una longitud de aproximadamente 2114 bases (P. Ahlquist y col. (1981) J. Mol. Biol. 153: 23). Se han producido clones de ADNc completos (P. Ahlquist y M. Janda (1984) Mol. Cell. Biol. 4: 2876). Los ARN 1 y 2 están encapsidados individualmente. El ARN3 está encapsidado junto con el ARN4, el mensaje de la proteína de cubierta subgenómica de 876 bases que se presume que no se replica in vivo (T. Lane (1974) Adv. Virus Res. 19: 151). Las moléculas de ARN purificadas a partir de partículas de virus y los transcritos preparados a partir de secuencias de ADNc vírico clonado son infecciosas en el sistema modelo de protoplasto de cebada (P. Ahlquist y col. (1984) Proc. Nat. Acad. Sci. USA 81: 7066). Por lo tanto, está disponible la gama completa de técnicas de biología molecular para el análisis de secuencias funcionales de ácido nucleico de BMV.

      Las manipulaciones experimentales del genoma clonado del BMV han comenzado a definir regiones de importancia funcional (P. Ahlquist y R. French (1988) en Domingo, Holanda y Ahlquist (eds.) RNA Genetics Book 2: RNA Variability, Chapter 3, CRC Press, Orlando, Florida). Ambos ARN 1 y 2 y sus productos génicos son necesarios para la síntesis de ARN viral. Los ARN1 y 2 codifican proteínas no estructurales 1a y 2a respectivamente, y estas proteínas determinan la actividad ARN polimerasa dependiente de ARN. El ARN3 codifica la proteína no estructural 3a y la proteína de la cubierta, pero no se requiere ni el ARN3, la proteína 3a ni la proteína de la cubierta para la replicación del ARN viral (R. French y P. Ahlquist (1986) Science 231: 1294). El ARN3 se puede modificar mediante la inserción de un gen extraño en lugar del gen de la proteína de la cubierta, o mediante ciertas deleciones, sin perder la capacidad de replicación (solicitud de patente de EE.UU. al. (1986) Science 231: 1294). El ARN3 ha sido bien estudiado porque sus productos génicos no son necesarios para la replicación del ARN (French et al. 1986). Hay regiones en los extremos no codificantes 5 'y 3' de la molécula que tienen homólogos en los ARN 1 y 2, y se ha propuesto que estas secuencias pueden funcionar en el reconocimiento de la ARN polimerasa viral, el inicio de la encapsidación, la protección de las moléculas de nucleasas celulares, o una combinación de estas funciones. Los estudios de deleción que utilizan ADNc clonado y transcripciones in vitro han demostrado que se requieren porciones de los extremos 5 'y 3' para la replicación del ARN genómico, y que también hay un efecto gradual de las deleciones en la región intercistrónica del ARN3 (R. French y P. Ahlquist (1987) J. Virol. 61: 1457). Una característica de la región intercistrónica es un tracto de oligo (A), que varía de 16 a 22 nucleótidos de longitud en poblaciones de virus naturales (P. Ahlquist y col. (1981) J. Mol. Biol. 153: 23). El promotor subgenómico de BMV también se encuentra en la región intercistrónica. Ni los promotores genómicos ni subgenómicos del BMV son reconocidos por las ARN polimerasas del hospedador, solo las células infectadas por virus tienen actividad ARN polimerasa dependiente de ARN capaz de responder a estas señales.

      W. Miller y col., 1985, Nature 313: 68, establecieron que la producción de ARN4, que sirve como mensaje para la proteína de la cubierta, se produce por el inicio de la síntesis de ARN dentro de la molécula de la cadena de ARN3 (-). (-) las hebras de ARN3 que terminan en el sitio BglII aproximadamente 21 bases corriente arriba del sitio de iniciación del ARN4 pudieron dirigir la producción de ARN4 (Miller et al. (1985) L. Marsh et al. (1987) en Positive Strand RNA Viruses, Nueva York , Alan R. Liss, Inc., págs. 327 a 336. Estos estudios y un estudio de R. French et al. (1986) Science 231: 1294, muestran que las deleciones e inserciones en o aguas abajo del sitio SalI, que es aproximadamente 17 bases aguas abajo del sitio de inicio, no interfieren con la producción de ARNm subgenómico. French et al, 1986, demostraron la expresión de genes extraños insertados adecuadamente por la vía subgenómica. Por lo tanto, se pensó que la actividad del promotor subgenómico del BMV estaba localizada en un 37 región de bases que en el clon de ADNc se encuentra entre los sitios BglII y SalI. Marsh et al. (1987) también presentaron evidencia de experimentos in vitro de que el límite 5 'de la actividad del promotor subgenómico del BMV no estaba más arriba que el sitio BglII aproximadamente 21 bases corriente arriba del sitio de inicio del RNA4. Marsh et al. l. (1987) también declararon, sin evidencia, que el tracto poli (A) algo más aguas arriba del sitio de iniciación del ARN4 mejoró la actividad promotora. Tanto los estudios de Miller et al. (1985) y los de Marsh et al. (1987) utilizaron experimentos de expresión in vitro para examinar los requisitos de la transcripción; sus resultados no indicaron que la información de la secuencia de nucleótidos tan corriente arriba como -95 pudiera contribuir al nivel de síntesis de ARNm de la cadena (+). Ni Miller et al. (1985) ni Marsh et al. (1987) informaron sobre la actividad de la transcripción subgenómica, ya que en sus construcciones faltaban las secuencias 5 'del promotor putativo. Ningún estudio publicado ha descrito el uso de un fragmento de ácido nucleico que contenga un promotor subgenómico que podría transferirse a una nueva ubicación deseada para generar un nuevo ARNm subgenómico.

      La presente invención enseña el uso de secuencias de nucleótidos que funcionan como un promotor subgenómico de un virus de ARN de cadena (+) para dirigir la expresión amplificada de un gen estructural en tejido vegetal, tejido animal o células protistas por ARN polimerasa dependiente de ARN. Este es el primer caso en el que se han identificado las secuencias de nucleótidos que identifican la región central y un dominio de activación cadena arriba del promotor subgenómico de un virus de cadena (+). Este promotor subgenómico se puede utilizar en un virus modificado, o en un derivado de ADNc recombinante diseñado apropiadamente que puede integrarse cromosómicamente o mantenerse como un episoma en células transformadas. La invención está ejemplificada por el promotor subgenómico del ARN3 del virus del mosaico de brome (BMV), pero las enseñanzas de la presente invención permiten a un experto en la materia seleccionar y usar secuencias promotoras subgenómicas de virus de ARN de cadena (+) similares para su uso en cualquier célula deseada. escribe. El promotor subgenómico de BMV se compone de dos partes: el promotor central, identificado por la secuencia de nucleótidos de aproximadamente -21 a aproximadamente +16, como en la FIG. 2, que es suficiente para dirigir la transcripción subgenómica, y un dominio de activación, identificado por la secuencia de nucleótidos de aproximadamente -95 a aproximadamente -22, como en la FIG. 2. El dominio de activación actúa mejor para aumentar el nivel de transcripción subgenómica cuando dicho dominio de activación está situado corriente arriba y en la orientación adecuada con respecto a dicho promotor central. La transcripción subgenómica depende de la actividad de la ARN polimerasa dependiente de ARN y de una molécula de ARN de cadena (-) que contiene el promotor subgenómico y el gen estructural, por ejemplo, el promotor subgenómico de BMV es reconocido por las actividades de ARN polimerasa dependiente de ARN codificadas por virus de ARN, incluidos, entre otros, limitado a virus del mosaico del bromo y virus del moteado clorótico del caupí. Otras mejoras en la técnica existente son que la duplicación cadena arriba del dominio de activación del promotor subgenómico puede aumentar el nivel de transcripción subgenómica sobre el dirigido por un promotor subgenómico de copia única y que múltiples copias del promotor subgenómico pueden dirigir la síntesis de más de uno. Molécula de ARNm subgenómico de una plantilla de ARN de una (-) hebra.

      Un objeto principal de la invención es proporcionar una molécula de ADN recombinante que contiene una copia de ADN del promotor subgenómico de un virus de ARN de cadena (+) y un gen estructural, en donde la expresión de dicho gen es un proceso de dos pasos: polII de un huésped la célula transcribe una molécula de ARN de cadena (-) que lleva la secuencia funcional del promotor subgenómico y la secuencia complementaria de dicho gen estructural, en donde la síntesis de ARN con sentido del mensaje está bajo el control de dicho promotor subgenómico. En una realización, el promotor subgenómico del ARN3 del virus del mosaico de brome dirige la expresión de un gen estructural corriente abajo. La ARN polimerasa II del tejido vegetal modificado genéticamente sintetiza una molécula de ARN que es una copia funcional (-) con sentido del promotor subgenómico y una copia con (-) sentido del gen estructural. Una ARN polimerasa dependiente de ARN, que puede ser una replicasa de ARN viral de BMV, reconoce el promotor subgenómico y sintetiza una molécula de ARN con sentido (+) o sentido de mensaje funcional que luego puede traducirse en proteína. La actividad de la ARN polimerasa dependiente de ARN que responde al promotor subgenómico del BMV en la molécula de ARN de la cadena (-) puede provenir de información genética del virus del mosaico del bromo o del virus del moteado clorótico del caupí, o de una molécula de ADN recombinante que codifica, por ejemplo, 1a y 2a genes del BMV, en los que dichos genes pueden traducirse en proteína después de la transcripción por la ARN polimerasa II de la célula huésped en respuesta a un promotor constitutivo o bajo el control regulador de un elemento regulador de la planta.

      Otro objeto de la invención es proporcionar un método para la expresión génica amplificada en células transformadas compuesto por las etapas de introducir en una célula huésped deseada una molécula de ADN recombinante que contiene un promotor subgenómico de un virus de ARN de cadena (+) y un gen, en el que la expresión del gen está bajo el control regulador del promotor subgenómico y en el que la expresión de ese gen depende de la transcripción por la ARN polimerasa II celular del huésped para producir una molécula de ARN de cadena (-) que lleva la forma activa del promotor subgenómico y subsiguiente transcripción subgenómica del gen para producir ARNm con sentido (+) activo mediante actividad ARN polimerasa dependiente de ARN, y luego traducción del transcrito subgenómico para producir el polipéptido codificado por el gen estructural. La transcripción de la polII del huésped puede controlarse mediante un promotor de la polII constitutivo, inducible o no reprimible.

      En las figuras, ya lo largo de la solicitud, las secuencias que son el promotor subgenómico se presentan como las secuencias de la cadena (+), que se entenderá que son el complemento de las secuencias promotoras subgenómicas activas.

      BREVE DESCRIPCIÓN DE LAS FIGURAS

      HIGO. 1 presenta un mapa esquemático de BMV RNA3. Las regiones no codificantes se muestran como una sola línea, los genes 3a y coat como cajas abiertas, el oligo (A) como una pequeña caja llena y una flecha doblada marca la posición del inicio de las secuencias que codifican el ARN4 subgenómico. De acuerdo con la práctica común, se muestra la secuencia de la hebra empaquetada (+), pero debe tenerse en cuenta que la secuencia complementaria sirve como molde para la síntesis de ARN subgenómico. La numeración en esta figura y en las figs. 3, 4, 5 y 6, figuras posteriores, corresponde a la de la secuencia publicada para RNA3 (P. Ahlquist y col. (1981) J. Mol. Biol. 153: 23). Los sitios de restricción de endonucleasas se reconocen en las moléculas de ADNc que llevan las secuencias de ARN3.

      HIGO. 2 muestra la secuencia de nucleótidos del fragmento AvaI-SalI del ARN correspondiente al clon de ADNc del virus del mosaico del bromo ARN3, cuyo fragmento comprende la secuencia del promotor subgenómico del BMV y el sitio de inicio de la transcripción subgenómica en la molécula de ARN de la cadena (-) . Los sitios de restricción mostrados son para el cDNA correspondiente. Dentro de las secuencias mostradas, los sitios AvaI, BglII y SalI que se unen al promotor central están subrayados y el codón de iniciación de la proteína de cubierta y el tracto oligo (A) están subrayados. Una flecha doblada marca el comienzo de la transcripción subgenómica (ARN4) y se proporciona la secuencia del extremo 5 'de la molécula de ARN4 protegida.

      HIGO. 3. Diagrama esquemático de las regiones que rodean el ADNc del gen de la cubierta en los plásmidos pB3TP8 (tipo salvaje), pB3SG5 y pB3SG6. El fragmento AvaI-SacI duplicado en pB3SG5 está entre corchetes sobre la secuencia de tipo salvaje y sombreado en sus nuevas ubicaciones en pB3SG5 y pB3SG6. Los sitios de inicio para los ARN subgenómicos 4 y 4 'se muestran mediante flechas dobladas. Para pB3SG5 y pB3SG6, las relaciones RNA4 ': RNA3 fueron 2,4 y 3,3 respectivamente. Para el plásmido de tipo salvaje y pB3SG5, las relaciones ARN4: ARN3 fueron 1,2 y 0,4, respectivamente.

      HIGO. 4. Efectos de las deleciones 5 'sobre la actividad promotora subgenómica. La secuencia que rodea el sitio de iniciación de ARN proximal 3 'en el derivado pB3SG5 y el mapa de deleciones en los derivados pB3SG21, 22 y 15. pB3SG11 es el plásmido que representa las secuencias no eliminadas. Los valores dados para las relaciones molares de ARN4 ': ARN3 son los promedios de dos o más experimentos independientes.

      HIGO. 5. Efectos de las duplicaciones aguas arriba sobre la actividad del promotor subgenómico. Mapa de la región intercistrónica de RNA3 de tipo salvaje (wt) y secuencias duplicadas en derivados de RNA3 pB3IC2, 5 y 6. En cada uno de estos derivados, el segmento indicado de secuencia intercistrónica se inserta como una duplicación inmediatamente 5 'a la posición 1015 en el Secuencia de ARN3. Los valores dados para las relaciones molares de ARN4 ': ARN3 son los promedios de tres experimentos independientes. A modo de comparación, las proporciones de ARN4 ': ARN3 obtenidas sin duplicaciones de información aguas arriba son generalmente alrededor de 2,4 para construcciones similares.

      HIGO. 6. Producción de múltiples transcripciones subgenómicas a partir de derivados individuales de RNA3. Mapas esquemáticos de los derivados de ARN3 pB3SG5, 7, 9, 10, 13 y 14. En cada línea, las flechas de cabeza abierta indican los sitios de inserción de copias adicionales del fragmento AvaI-SacI que abarca el sitio de iniciación del ARN4. Encima de cada flecha se da la relación molar de ese ARN subgenómico al derivado de ARN3 genómico, promediado de dos o más experimentos independientes. Cada valor también se representa como una barra de histograma para realizar una comparación visual. Las flechas con cabezas llenas representan el promotor de ARN4 inalterado en su contexto de tipo salvaje. La relación media de producción de ARN4 subgenómico a ARN3 genómico en la infección de tipo salvaje en estas condiciones es 1,2.

      HIGO. 7 (A). Alineación de la secuencia AvaI-SalI de BMV RNA3 para enfatizar la presencia de repeticiones directas imperfectas. Este análisis fue asistido por computadora. La secuencia promotora del núcleo BglII-SalI se muestra dentro del recuadro sólido indicado. También está marcado el codón de iniciación de la capa, que se superpone al sitio SalI.

      HIGO. 7 (B). Alineación de secuencias que muestra la similitud entre los ARN genómicos del BMV, los alfavirus animales, el virus del moteado clorótico del caupí (CCMV) y el virus del mosaico de la alfalfa (ALMV) cerca del comienzo de las secuencias que codifican los ARNm subgenómicos para las proteínas de la cápside. Existe una gran brecha en cada secuencia de virus de plantas introducida únicamente para lograr la alineación con la secuencia de consenso de alfavirus. La flecha doblada muestra el comienzo de las secuencias de ARN subgenómico y los codones de iniciación de los genes de la proteína de la cubierta del BMV y CCMV están subrayados. Estos alineamientos se generaron por ordenador usando secuencias publicadas en ningún virus distinto del BMV si se ha determinado empíricamente el promotor subgenómico real. El consenso de alfavirus se derivó de las secuencias de los virus Sindbis, Middelburg, Semliki Forest y Ross River (J.-H. Ou y col. (1982) Proc. Natl. Acad. Sci. USA 79: 5235). La secuencia ALMV RNA3 es de R. Barker et al. (1983) Nucleic Acids Res. 11: 2881, y la secuencia de CCMV RNA3 fue determinada por P. Ahlquist et al. (1981) Cell 23: 183.

      HIGO. 8 presenta representaciones esquemáticas de la replicación del virus ARN normal y el sistema de expresión de dos etapas que utiliza el promotor subgenómico para la transcripción amplificada.

      HIGO. 8A proporciona el esquema de la síntesis de cadenas (-) y (+) sucesivas que amplifican el ARN viral en una infección normal de las células huésped.

      HIGO. 8B proporciona el esquema para la amplificación similar de un transcrito cromosómico mediante síntesis citoplásmica de múltiples copias complementarias de un promotor subgenómico viral. El transcrito primario no traducible, que en sí mismo es una hebra (-) con respecto a la secuencia codificante del gen expresable en plantas, es sintetizado por la ARN polimerasa II celular en respuesta a un promotor polII. La actividad de la ARN polimerasa dependiente de ARN, como la inducida por los genes 1a y 2a del BMV, es necesaria para lograr la transcripción subgenómica de un ARNm con sentido (+) dirigido por las secuencias promotoras subgenómicas presentes en forma activa en la cadena (-) primaria transcripción de la molécula de ARN. El tejido vegetal puede modificarse genéticamente para contener el gen o genes que codifican la actividad de la ARN polimerasa dependiente de ARN bajo el control regulador de la ARN polimerasa II, o esa actividad puede expresarse durante la infección viral. Debido a que la polaridad de la transcripción primaria es opuesta a su producto ARN subgenómico, la traducción de genes orientados apropiadamente solo ocurre a partir de la transcripción subgenómica secundaria. Por tanto, este esquema proporciona control de la inducción y amplificación de la expresión.

      DESCRIPCIÓN DETALLADA DE EL INVENTO

      Se proporcionan las siguientes definiciones, con el fin de eliminar ambigüedades en la intención del alcance de su uso en la especificación y las reivindicaciones.

      Un virus de ARN, como se usa en este documento, significa un virus cuyo genoma es ARN en forma monocatenaria, siendo la cadena sencilla una (+), o cadena con sentido mensajero. La replicación de la hebra viral (+) en una célula se produce mediante un proceso de replicación directa del ARN y, por tanto, se distingue del mecanismo de replicación retroviral que se caracteriza por un paso intermedio de transcripción inversa en la célula huésped.

      El término promotor subgenómico se refiere a aquellas secuencias dentro de una molécula de ARN y en el extremo 5 'de un gen estructural, que dirigen la síntesis de ARN mensajero utilizando dicha molécula de ARN como plantilla. Es necesario un promotor subgenómico para impulsar la expresión de genes usando ARN como molde. El promotor subgenómico es reconocido por una ARN polimerasa dependiente de ARN, que puede ser una replicasa de ARN viral. El propio promotor puede ser un compuesto de segmentos derivados de más de una fuente, de origen natural o sintético. Cabe señalar que un promotor subgenómico se ubica en relación con el gen particular cuya transcripción inicia, y es reconocido funcionalmente por una ARN polimerasa dependiente de ARN (o replicasa de ARN viral) cuando está contenido dentro de una molécula de ARN del tipo adecuado. (-) polaridad. La molécula de ARN con sentido (-) que contiene la copia funcional del promotor subgenómico, que comprende las unidades funcionales del promotor central y el dominio de activación, puede sintetizarse mediante la polinerasa de ARN dependiente de ARN utilizando una molécula de ARN con sentido (+) como plantilla, o puede haber sido sintetizado por la ARN polimerasa II (celular) como una transcripción iniciada por un promotor polII. Una realización específica de la presente invención es el promotor subgenómico del ARN3 del virus del mosaico del bromo (BMV). La secuencia de identificación del promotor subgenómico de BMV se proporciona en la FIG. 2. Por coherencia en el presente documento, la posición del promotor subgenómico del virus del mosaico de bromo se ha proporcionado con respecto al sitio de inicio del ARNm subgenómico, que se designa +1. El promotor subgenómico de BMV comprende la secuencia de nucleótidos que se extiende desde aproximadamente -95 hasta aproximadamente +17, como en la FIG. 2, la secuencia comprendida dentro de la región de aproximadamente -74 a aproximadamente +16 también constituye un promotor subgenómico funcional.

      El promotor central de un promotor subgenómico incluye la secuencia mínima requerida para la función. En el caso de BMV, el promotor central comprende la secuencia de nucleótidos de aproximadamente -21 a aproximadamente +17, como en la FIG. 2. Cuando se coloca correctamente como se entiende en la técnica, el promotor central es suficiente para dirigir el inicio de la síntesis del mensaje por una ARN polimerasa dependiente de ARN de modo que se sintetizan moléculas de ARN de cadena (+).

      El dominio de activación de un promotor subgenómico incluye secuencias que aumentan la actividad del promotor central, lo que permite una mayor síntesis de transcripciones subgenómicas. En el caso de BMV, el dominio de activación que puede aumentar la síntesis de ARNm dirigido por un promotor subgenómico, o un promotor del núcleo subgenómico, en relación con los niveles obtenidos cuando solo están presentes las secuencias del promotor del núcleo, comprende la secuencia de nucleótidos entre aproximadamente -95 y aproximadamente -22, como en la FIG. 2. Se obtiene algo menos de activación con la secuencia de aproximadamente -74 a aproximadamente -22.

      La ARN polimerasa dependiente de ARN aquí se refiere a una enzima sintética de ARN que inicia fielmente la síntesis de ARN de la cadena (+) en respuesta a una secuencia de ARN que es un promotor subgenómico, y que está contenida dentro de una molécula de ARN que tiene (-) sentido en relación con la codificación región del gen estructural asociado. Por ejemplo, los genes 1a y 2a del BMV determinan la actividad de la ARN polimerasa dependiente de ARN en las células dentro de las cuales se expresan esos genes, y esa actividad de la ARN polimerasa dependiente de ARN reconoce los promotores subgenómicos que incluyen, entre otros, los del virus del mosaico del bromo y virus del moteado clorótico del caupí.

      El término transcripción subgenómica se refiere en este documento a la síntesis de ARN por una ARN polimerasa dependiente de ARN en la que dicha ARN polimerasa dependiente de ARN usa una hebra (-) de ARN como molde, y en la que dicha ARN polimerasa dependiente de ARN inicia la síntesis de ARNm en respuesta a la información de la secuencia de nucleótidos contenida en el promotor subgenómico.

      El término ARN de cadena (+) se refiere a ARN que tiene sentido mensajero con respecto a las regiones codificantes.

      El término ARN con sentido (-) se refiere a secuencias que son el complemento de moléculas con sentido (+). Por ejemplo, la molécula de ARN con sentido (-) correspondiente a un gen estructural es complementaria en secuencia al mensaje, y la molécula de ARN con sentido (-) no puede actuar por sí misma como un mensaje para la traducción de la proteína correspondiente.

      El término promotor de polII en este documento se refiere a secuencias de ADN en el extremo 5 'de genes que dirigen el inicio de la transcripción por la enzima ARN polimerasa II dependiente de ADN de células vegetales o animales. Las secuencias promotoras son necesarias, pero no siempre suficientes, para impulsar la expresión de genes posteriores. El propio promotor puede ser un compuesto de segmentos derivados de más de una fuente, de origen natural o sintético. Los promotores eucariotas polII se identifican comúnmente por la presencia de secuencias de ADN homólogas a la forma canónica 5 '- TATAA - 3' (caja "TATA") aproximadamente 10-30 pb 5 'a la ubicación del extremo 5' del ARNm (sitio cap, +1). Aproximadamente 30 pb en 5 'de la caja TATA, a menudo, pero no siempre, se encuentra otra secuencia de componente promotor que se identifica por la presencia de secuencias de ADN homólogas a la forma canónica 5'-CCAAT -3'. Para los propósitos de la presente descripción, un promotor polII se define para incluir una secuencia de ADN que se extiende hasta aproximadamente 100 pb en 5 '(- 100) hasta el sitio cap. Cualquier secuencia adicional que pueda estar ubicada de 5 'a -100, y que pueda contener una funcionalidad que incluya, pero no se limite a, la del elemento activador de la transcripción o las secuencias que ejercen la regulación en respuesta a los estímulos ambientales, se consideran elementos asociados al promotor, pero para la propósitos de esta solicitud, se consideran parte del promotor polII, aunque dichas secuencias pueden ser reconocidas por proteínas celulares distintas de la ARN polimerasa II dependiente de ADN. (Se dice que una polimerasa "reconoce" una secuencia de ADN particular si esa secuencia es necesaria o tiene un efecto regulador sobre el inicio de la transcripción por parte de la polimerasa). Cabe señalar que un promotor de polII generalmente se ubica en 5 'con respecto al gen particular cuyo transcripción que inicia. Esa transcripción puede ser una molécula de ARN de sentido (+) que puede servir como mensaje o puede ser una molécula de ARN de cadena (-) que puede servir como molde para la síntesis de ARN posterior.

      La expresión se refiere a la transcripción y traducción de un gen estructural para que se produzca una proteína. La expresión génica se puede evaluar mediante detección directa del producto proteico, mediante electroforesis en gel de proteína o métodos inmunológicos, por ejemplo. A menudo, la expresión se evalúa mediante la detección de los productos de transcripción del ARNm. Este método es particularmente apropiado para la evaluación de factores de control de la transcripción, como los elementos promotores, ya que se excluyen los efectos de los procesos no transcripcionales, como la degradación de proteínas.

      Un gen estructural se refiere a la combinación de secuencias de nucleótidos que codifican una proteína y (algunas de) las secuencias reguladoras que permiten la expresión de ese gen estructural en una célula o tejido vegetal. El término gen estructural se refiere a la parte de un gen compuesta por un segmento de ADN que codifica una proteína, polipéptido o parte del mismo, que posiblemente incluye un sitio de unión a ribosoma y / o un codón de inicio de la traducción. El término también puede referirse a copias de un gen estructural que se encuentra naturalmente dentro de la célula, pero introducido artificialmente. En este caso, un gen estructural que se encuentra naturalmente en una célula puede reintroducirse en una célula como parte de un gen quimérico que tiene secuencias de control reguladoras no naturales, por ejemplo, bajo el control del promotor subgenómico de BMV. El gen estructural puede codificar una proteína que normalmente no se encuentra en la célula vegetal en la que se introduce el gen, en cuyo caso se denomina gen estructural extraño. Un gen estructural extraño puede derivarse total o parcialmente de un genoma o episoma bacteriano, ADN eucariota nuclear o plástido, ADNc, ADN viral o ADN sintetizado químicamente. Se contempla además que un gen estructural puede contener una o más modificaciones en los segmentos codificantes o en las regiones no traducidas que podrían afectar la actividad biológica o la estructura química del producto de expresión, la tasa de expresión o la forma de control de la expresión. . Tales modificaciones incluyen, pero no se limitan a, inserciones, deleciones y sustituciones de uno o más nucleótidos. El gen estructural puede constituir una secuencia de codificación ininterrumpida o puede incluir uno o más intrones, unidos por uniones de corte y empalme funcionales de la célula huésped. El gen estructural puede ser un compuesto de segmentos derivados de una pluralidad de fuentes, naturales o sintéticas. Ese gen estructural también puede producir una proteína de fusión. Se contempla que la introducción en células huésped de ADN recombinante que contiene el gen estructural en combinación con un promotor subgenómico o con un promotor polII incluirá construcciones en las que el gen estructural no se deriva del mismo tipo de célula que el huésped, y construcciones en el que copias adicionales de genes de origen natural se expresan bajo el control del promotor subgenómico de BMV.

      Una molécula de ADN recombinante es una que se ha producido de forma natural o artificial a partir de partes derivadas de fuentes heterólogas, partes que pueden ser moléculas de origen natural o sintetizadas químicamente, y en las que esas partes se han unido mediante ligación u otros medios conocidos en la técnica.

      El tejido vegetal incluye tejidos diferenciados e indiferenciados de plantas que incluyen, entre otros, raíces, brotes, hojas, polen, semillas, tejido tumoral como agallas de la corona y diversas formas de agregaciones de células vegetales en cultivo como embriones y callos. El tejido vegetal puede estar en planta o en cultivo de órganos, tejidos o células.

      El término sintetizado químicamente, relacionado con una secuencia de ADN, significa que los nucleótidos componentes se ensamblaron in vitro utilizando medios no enzimáticos. La síntesis manual de ADN se puede lograr usando procedimientos bien establecidos (es decir, M. Caruthers (1983) en Metodología de secuenciación de ADN y ARN, Weissman (ed.), Praeger Publishers (Nueva York) Capítulo 1) o la síntesis automatizada se puede realizar usando una de una serie de máquinas disponibles comercialmente.

      La homología, como se usa en el presente documento, se refiere a la identidad de las secuencias de nucleótidos. El grado de homología entre secuencias de ADN puede determinarse empíricamente en experimentos de hibridación de ADN, tales como los descritos en B. Hames y S. Higgins (1985) Nucleic Acid Hybridisation, IRL Press, Oxford, Reino Unido.

      Debido a que existe cierta flexibilidad con respecto a las secuencias transportadas en BMV RNA3, fue posible examinar cómo ciertas secuencias de RNA en la región intercistrónica contribuyeron a la actividad del promotor subgenómico. Se sabía que el inicio de la síntesis de ARN subgenómico no requiere más de 16 bases aguas abajo del sitio de inicio (es decir, 3 'al comienzo de las secuencias de ARN4 en el ARN con sentido del virión) (W. Miller et al. (1985) Nature 313 : 68 R. French y otros (1986) Science 231: 1294 L. Marsh y otros (1987) en Positive Strand RNA Viruses, Alan R. Liss, Inc., Nueva York, páginas 327-336). Se utilizaron transcripciones infecciosas in vitro sintetizadas a partir de clones de ADNc de ARN3 modificados genéticamente para determinar los efectos de las alteraciones en la estructura primaria de ARN3. En las Figs. Se proporciona un mapa de restricción del clon de cDNA de BMV RNA3 y la secuencia de nucleótidos de la región AvaI-SalI que rodea los sitios de inicio de la transcripción subgenómica. 1 y 2.Una característica notable de la secuencia aguas arriba del sitio de inicio del mensaje subgenómico es un tracto oligo (A) que se conserva en posiciones genómicas equivalentes en otros miembros del grupo de bromovirus (P. Ahlquist et al. (1981) Cell 23: 183 observaciones no publicadas ). Para determinar si el tracto oligo (A) afecta la actividad del promotor subgenómico, se construyó el plásmido mutante pB3IC4, que carece de todos los residuos A menos uno. Ese transcrito de ARN3 in vitro poseía menos del 10% de la actividad promotora subgenómica parental in vivo. La longitud del tracto oligo (A) varía de 16 a 22 en poblaciones naturales de ARN3 (P. Ahlquist y col. (1981) J. Mol. Biol. 153: 23). En pB3TP8 hay 18 residuos A (M. Janda y col. (1987) Virology 158: 259). Los promotores subgenómicos que contienen tractos de oligo (A) que difieren en longitud de los 18 como en la FIG. 2, se considerará funcionalmente equivalente al promotor subgenómico de BMV de la FIG. 2, siempre que se mantengan cantidades similares de información de secuencia que flanquea el oligo (A).

      En el sistema de prueba, las transcripciones de ARN3 parentales produjeron ARN de cadena de progenie (+) en una proporción de ARN4: ARN3 de 1,2. Para separar los efectos de los cambios de secuencia en la región intercistrónica sobre la producción de mensajes subgenómicos de los efectos sobre la amplificación del ARN3 genómico, se estableció un segundo sitio de iniciación subgenómico insertando el fragmento AvaI-SacI de ADNc que abarca el sitio de comienzo en el sitio XbaI del ADNc de ARN3. para crear pB3SG5 (Figura 3). Los transcritos de pB3SG5 se replicaron y dirigieron la síntesis de dos ARN subgenómicos como se pretendía. El ARNm subgenómico producido a partir de la copia manipulada del promotor subgenómico (ARN4 ') fue más abundante que tanto el ARN3 genómico como el ARNm subgenómico que se originó a partir del promotor subgenómico de tipo salvaje. Se obtuvo una relación de ARN4 ': ARN3 de 2,4: 1 a partir de pB3SG5. pB3SG6, que contenía sólo una copia del promotor subgenómico en la misma ubicación distal que la de pB3SG5, produjo ARN subgenómico y genómico en una proporción de 2,5: 1.

      Los tamaños de las especies de ARN subgenómico obtenidas con pB3SG5 y pB3SG6 fueron consistentes con la iniciación de los sitios esperados en las secuencias promotoras duplicadas. Los experimentos de extensión del cebador confirmaron que el sitio de inicio para la síntesis de ARN subgenómico no cambió incluso cuando el promotor subgenómico se movió a una nueva ubicación o se duplicó dentro del clon de ADNc de ARN3. Al igual que el ARN4 de tipo salvaje (R. Dasgupta y col. (1976) J. Virol. 18: 260), el ARN subgenómico producido a partir del nuevo sitio de iniciación del ARN subgenómico estaba protegido.

      Se examinó la funcionalidad adicional de las secuencias de ARN en la región cadena arriba del sitio de inicio del ARN subgenómico determinando los efectos de una serie de mutaciones de inserción y deleción internas sobre la síntesis de ARNm subgenómico en tejido vegetal. Se estableció un segundo promotor subgenómico funcional distal a la región intercistrónica, por lo tanto, fue posible usar análisis de deleción para investigar los límites 5 'de secuencias que contribuyen a la síntesis de ARN subgenómico sin efectos significativos sobre la acumulación de ARN3 de longitud completa. En las infecciones por protoplastos, estas deleciones indujeron una disminución progresiva obvia en la producción de ARN subgenómico a medida que las deleciones se extendían más en 5 '. La acumulación disminuida debe reflejar una síntesis reducida porque la secuencia del ARN subgenómico y, por lo tanto, su estabilidad, no se modificó en las diversas construcciones. Los resultados se resumen en la FIG. 4. pB3SG11 portaba el fragmento AvaI-SalI que contenía aproximadamente 95 bases corriente arriba de hasta aproximadamente 16 bases corriente abajo del inicio de la transcripción subgenómica. La relación ARN4 ': ARN3 de 2,5 era similar a la de pB3SG5, que transportaba la información de la secuencia a través del sitio SacI hasta el gen de la proteína de la cubierta. pB3SG21, que contiene secuencias promotoras subgenómicas desde el sitio BstXI aproximadamente -74 hasta el sitio SalI aguas abajo del sitio de inicio, produjo una relación ARN4 ': ARN3 similar a la relación ARN4: ARN3 del plásmido de tipo salvaje, pero menor que la de pB3SG11 . Otras deleciones de la región aguas arriba dieron más disminuciones en las proporciones de ARN4 ': ARN3. pB3SG15 fue el plásmido con el fragmento de promotor subgenómico más corto (BglII-SalI). La relación RNA4 ': RNA3 fue de 0,3: 1, lo que demuestra que la eficacia del promotor subgenómico truncado era limitada. Por lo tanto, el extremo 5 'del promotor central no está más allá de 5' que -21, y toda la información necesaria para una iniciación eficiente es de 3 'a aproximadamente -95, con resultados similares a los de la proporción de plásmidos de tipo salvaje cuando solo aproximadamente 74 están presentes bases de información aguas arriba. Por lo tanto, el fragmento BglII-SalI, de aproximadamente -21 a aproximadamente +16 como en la FIG. 2, comprende el promotor del núcleo subgenómico de BMV. El fragmento AvaI-SalI, de aproximadamente -95 a aproximadamente +16, como en la FIG. 2, y el fragmento BstXI-SalI, de aproximadamente -74 a aproximadamente +16, como en la FIG. 2, ambos contienen el dominio activador y las actividades del promotor central del promotor subgenómico.

      La duplicación de secuencias del dominio de activación del promotor subgenómico de la región intercistrónica de ARN3 en un sitio unas 220 bases corriente arriba del sitio de inicio para la transcripción subgenómica condujo a una estimulación en la síntesis de ARN subgenómico. Las estructuras y las proporciones de ARN4: ARN3 para los plásmidos de tipo salvaje y mutantes se dan en la FIG. 5. Se logró una estimulación significativa de la síntesis de ARN subgenómico duplicando la secuencia contenida dentro del dominio de activación, un fragmento AvaI-BglII de aproximadamente -95 a aproximadamente -21 del ADNc del ARN3 cadena arriba del sitio de inicio del ARN. Si bien el tracto oligo (A) contribuyó a esa estimulación, no fue necesario para que ocurriera la estimulación.

      Para determinar si los sitios distintos del sitio XbaI podrían soportar la síntesis de ARN subgenómico cuando el fragmento AvaI-SacI estaba presente, el fragmento AvaI-SacI de ARN3 se duplicó en un sitio ClaI 5 'al sitio de inicio del ARN4 normal en pB3SG7. Ambos promotores subgenómicos eran funcionales y, como en otros casos en los que había dos copias del promotor subgenómico, el más pequeño de los ARN subgenómicos era más abundante. También se construyeron clones de ADNc de ARN3 mutante para probar si más de dos promotores subgenómicos eran funcionales en un solo derivado de ARN3. pB3SG9 y pB3SG10 contenían cada uno dos fragmentos de promotor subgenómico AvaI-SacI mientras que pB3SG13 y pB3SG14 cada uno contenía tres. Se encontró que el promotor subgenómico era activo en cada ubicación probada, y en estos experimentos se observó un gradiente distinto que favorecía una mayor acumulación de ARN subgenómicos de los sitios proximales 3 '(Figura 6). La activación observada de la transcripción subgenómica es una consecuencia de las duplicaciones cadena arriba de los componentes del promotor subgenómico.

      La capacidad del fragmento del promotor subgenómico para funcionar en la orientación inversa con respecto al ADNc circundante se probó en pB3SG5R y pB3SG6R. No se observaron especies putativas de ARN subgenómico. En ambos casos, la inversión provocó una grave inhibición de la acumulación de ARN3. Para SG6R, con su repetición invertida de 26 b, sólo se pudo detectar una pequeña cantidad de RNA3 en sobreexposiciones de las autorradiografías, pero SG5R con su repetición invertida de 330 bp nunca dio una producción detectable de RNA3. No se detectaron especies de ARN "pseudo-subgenómico" iniciadas internamente de polaridad negativa a partir de ninguna de las construcciones.

      La inspección de la secuencia asistida por ordenador reveló que la región AvaI-SalI de 120 bases del cDNA de RNA3, que contiene el promotor central y el dominio de activación del promotor subgenómico, incluye varias repeticiones directas imperfectas (Figura 7). Las 30 bases superpuestas e inmediatamente 5 'al tracto oligo (A) tienen 67% de identidad con la región promotora del núcleo BglII-SalI, correspondiendo el límite 3' de esta duplicación precisamente al comienzo de la región codificante de la proteína de cubierta. Inmediatamente 5 'a esta duplicación hay un segmento claramente relacionado que también incluye una repetición de desajuste único del elemento consenso 5' - AUCUAUGUU - 3 '. Por tanto, casi toda la región promotora AvaI-SalI consiste en repeticiones o repeticiones parciales de secuencias relacionadas con el promotor central, puntuadas en un área por el oligo (A). Aunque similar en secuencia, las dos copias del motivo del promotor central que flanquea el oligo (A) claramente no eran equivalentes. Si bien la copia 3 'contiene un promotor débil pero funcional, no se detectó iniciación de ARN subgenómico en el sitio correspondiente en la copia 5' de este motivo.

      Como se muestra en la FIG. 7, la región del promotor oligo (A) / núcleo del BMV RNA3 contiene similitudes con las regiones análogas cerca de los sitios de inicio del ARNm subgenómico en algunos otros virus de ARN de plantas, incluido el virus del moteado clorótico del frijol caupí (CCMV) y el virus del mosaico de la alfalfa (AMV). El BMV es el único virus de ARN de cadena (+) para el que se han determinado experimentalmente las secuencias promotoras subgenómicas. HIGO. 7 también muestra la homología significativa de la secuencia de la región promotora subgenómica del BMV con la secuencia consenso justo corriente arriba del inicio del ARN subgenómico del alfavirus (tomado de J.-H. Ou et al. (1982) Proc. Natl. Acad. Sci. USA 79: 5235-5239) no se ha probado la funcionalidad de la secuencia consenso de alfavirus para dirigir la síntesis de ARN subgenómico. Las similitudes de secuencia mostradas en la FIG. 7 se superponen con el elemento consenso BMV AUCUAUGUU que, con desajustes únicos, se repite tres veces en el fragmento BMV AvaI-SalI (Figura 7A). Las deleciones de las secuencias repetidas cadena arriba (Figura 4) dieron como resultado una actividad promotora subgenómica disminuida. Además, se demostró que la síntesis de ARN4 procede correctamente a partir de un ARN3 de CCMV cuando se proporcionaron ARN1 y 2 de BMV en una coinfección y, de manera similar, las coinfecciones de ARN3 de BMV con ARN de CCMV 1 y 2 producen ARN4 sintetizado con precisión. Los estudios publicados anteriormente de la transcripción subgenómica de BMV se basaron en experimentos in vitro llevados a cabo utilizando extractos hechos de células de cebada infectadas con BMV (L. Marsh et al. (1987) en Positive Strand RNA Viruses, Alan R. Liss, Inc., Nueva York W. Miller y col. (1985) Nature 313: 68). El trabajo de la presente invención se realizó usando experimentos in vivo para estudiar la síntesis de ARN subgenómico. Los resultados actuales demuestran que la región BglII-SalI del cDNA para BMV RNA3 tiene alguna actividad promotora subgenómica in vivo, sin embargo, la información de secuencia corriente arriba del sitio BglII (la región AvaI-BglII de aproximadamente -95 a aproximadamente -21 con respecto al inicio site) constituye un dominio de activación que se requiere para la síntesis eficaz de ARN subgenómico por la ARN polimerasa dependiente de ARN. Además, el trabajo de la presente invención demostró que un fragmento de ADN (por ejemplo, el fragmento AvaI-SalI) que contiene el promotor subgenómico podría moverse a una nueva ubicación dentro de una secuencia de ARN con la actividad del promotor subgenómico retenida. Además, ahora se ha demostrado que varios promotores subgenómicos son funcionales dentro de un único derivado de ARN3 incluso si se encuentran en sitios separados que conducen a una pluralidad de transcripciones de ARN subgenómico. Además, se determinó que un fragmento que lleva el dominio de activación de un promotor subgenómico podría duplicarse cadena arriba del promotor subgenómico con el resultado inesperado de que se potencia la transcripción subgenómica.

      Una característica principal de la presente invención es el promotor subgenómico del virus del mosaico del bromo, que se identifica por la secuencia de nucleótidos como en la FIG. 2, nucleótidos -95 a +16 con respecto al sitio de inicio para la transcripción subgenómica. Esta secuencia de nucleótidos fue suficiente para dirigir la síntesis de ARN subgenómico desde un sitio nuevo en el genoma viral a niveles de tipo salvaje o mayores. Las secuencias de no más de aproximadamente 20 bases corriente arriba del sitio de inicio fueron suficientes para dirigir la iniciación específica a un nivel bajo, por lo que la región entre -21 y +16 se denomina promotor del núcleo subgenómico. Se requieren secuencias de al menos 74, pero no más de 95 bases cadena arriba para la actividad promotora completa. El tracto oligo (A) dentro de la región entre -21 y -74 es un elemento funcional importante en la actividad promotora subgenómica completa, y puede funcionar como un elemento de secuencia de reconocimiento o puede proporcionar espacio o flexibilidad entre otros elementos del promotor. No se conoce la función de los elementos de secuencia con homología con el elemento de consenso AUCUAUGUU, pero la analogía con la transcripción dependiente de ADN sugiere que estas secuencias podrían ser reconocidas por factores que actúan en trans para aumentar el nivel de transcripción subgenómica. Se obtuvieron incrementos adicionales en el nivel de transcripción subgenómica duplicando la información de secuencia del fragmento AvaI-BglII cadena arriba del sitio de inicio, como en las Figs. 2 y 5. El promotor subgenómico se puede usar para dirigir la expresión de un gen estructural cuando el promotor subgenómico está en un sitio diferente a su sitio normal dentro del derivado de RNA3, y se puede lograr la mejora de la transcripción subgenómica mediante la duplicación del dominio de activación. porción del promotor subgenómico.

      A partir de los datos presentados en el presente documento, los expertos en la técnica pueden llevar a cabo fácilmente la localización, el aislamiento y el uso de promotores subgenómicos de otras fuentes sin una experimentación excesiva. Los datos de secuencia comparativa de la FIG. 7 muestran una homología notable en una amplia gama de fuentes de ARN que se sabe que poseen promotores subgenómicos. A partir de tales datos, junto con los datos conocidos o fácilmente obtenibles sobre los sitios de inicio de la transcripción subgenómica, se pueden aislar y utilizar promotores subgenómicos equivalentes al de BMV RNA3 como se describe y ejemplifica en el presente documento. La homología reconocida y el modo de acción de las ARN polimerasas dependientes de ARN permiten la combinación mixta de promotor subgenómico y ARN polimerasa dependiente de ARN de fuentes heterólogas, o demostrado aquí para BMV y CCMV. Sin embargo, se entenderá que las diferencias en la velocidad de transcripción y la especificidad del promotor pueden conducir a diferencias cuantitativas en la expresión, dependiendo de la combinación particular de promotor y polimerasa empleada.

      Es un objeto de esta invención proporcionar un método para la expresión amplificada en tejido vegetal de un gen estructural bajo el control regulador de un promotor subgenómico de virus ARN, que en una realización puede ser el promotor subgenómico del virus del mosaico del bromo. El método consta de los siguientes pasos: introducir en el tejido vegetal una molécula de ADN recombinante que contiene el promotor subgenómico y un gen estructural de manera que la expresión de dicho gen esté bajo el control regulador del promotor subgenómico y toda la combinación sea de una polII convencional. promotor, constitutivo, inducible o no reprimible, síntesis por ARN polimerasa II celular de una transcripción de cadena (-) primaria que contiene el promotor subgenómico en su forma activa y el complemento de la secuencia codificante del gen estructural, y expresión de ARN dependiente Actividad de la ARN polimerasa (por ejemplo, por la infección del tejido vegetal modificado con el virus del mosaico de brome, o por la inducción de copias cromosómicamente integradas de los genes BMV 1a y 2a bajo el control de los promotores polII), seguida de transcripción subgenómica para producir una secundaria, ARNm de sentido (+) que codifica el gen estructural que luego se traduce para producir su producto proteico. Este esquema tiene la ventaja de que en ausencia de actividad ARN polimerasa dependiente de ARN, el gen estructural es completamente silencioso porque no se sintetiza ARN con sentido (+) y, por lo tanto, no puede haber traducción para producir el producto proteico de ese gen. Generalmente, los genes bajo el control regulador de los promotores de polII regulados y los elementos de secuencia asociados exhiben algún grado de expresión incluso en ausencia de condiciones inductoras. Por tanto, el uso de un promotor subgenómico es útil para prevenir la expresión de un gen que sería letal para la célula que lo expresa. Cuando un gen de este tipo está estrictamente controlado de modo que solo se exprese después de la infección con el virus, su expresión mata a la célula infectada antes de que se produzca la replicación y diseminación del virus. Este proceso constituye un medio eficaz para controlar la infección por virus en el tejido vegetal y, por tanto, una forma de prevenir daños a los cultivos y pérdidas económicas. Las ventajas de este esquema se perderían si el control de la expresión del gen letal no fuera prácticamente absoluto y, por lo tanto, no es factible con los promotores de polII de la técnica anterior.

      Otra consecuencia del uso de un promotor subgenómico es la rápida amplificación de la expresión una vez que está presente una ARN polimerasa activa dependiente de ARN. Por tanto, el promotor es útil para expresar cualquier gen cuando se desea una explosión repentina de expresión. Por ejemplo, se puede obtener una expresión rápida pero transitoria de resistencia a herbicidas de alto nivel proporcionando un gen de resistencia a herbicidas bajo el control del promotor subgenómico y una ARN polimerasa dependiente de ARN bajo el control de un promotor polII inducible o no reprimible. Este último se puede elegir para activar la expresión de la polimerasa en respuesta a un componente en la formulación del herbicida. Otras resistencias específicas pueden regularse de manera similar y serán especialmente útiles cuando la resistencia sea el resultado de la expresión de un gen que conduce a la producción de una sustancia tóxica de mal gusto o indeseable de otro modo. Se puede lograr una expresión transitoria de alto nivel de dicho gen usando un agente inductor inocuo, para producir la resistencia deseada precisamente en la etapa deseada en el ciclo de vida del organismo huésped. Más tarde, por ejemplo en la cosecha, cuando el gen no se expresa, la sustancia indeseable está ausente del tejido vegetal destinado al consumo.

      Los expertos en la técnica entenderán que el uso de combinaciones de promotor subgenómico-gen estructural no se limita a las plantas. Existen virus de ARN de cadena positiva para bacterias y células animales, así como para plantas, y se observa homología de promotores subgenómicos tanto para virus vegetales como animales. Por lo tanto, la expresión de un gen estructural bajo el control del promotor subgenómico se puede lograr en cualquier célula transformable que incluye, sin limitación, células vegetales, células animales y células bacterianas.

      La producción de tejido vegetal modificado genéticamente que contiene y expresa un gen estructural bajo el control transcripcional del promotor subgenómico de BMV combina las enseñanzas específicas de la presente divulgación con una variedad de técnicas y expedientes conocidos en la técnica. En la mayoría de los casos, existen expedientes alternativos para cada etapa del proceso. La elección de los expedientes depende de variables como la elección del sistema de vector para la introducción y mantenimiento estable del complejo de expresión, el tipo de célula, ya sea vegetal, animal o protista, a modificar y, en el caso de las plantas, la regeneración deseada. estrategia, y el gen estructural particular que se va a usar, todos los cuales presentan etapas de proceso alternativas que los expertos en la técnica pueden seleccionar y usar para lograr un resultado deseado.

      Los homólogos de genes estructurales o de otras secuencias pueden identificarse por la capacidad de sus ácidos nucleicos para hibridar de forma cruzada en condiciones de rigurosidad apropiada como se entiende bien en la técnica. Se entenderá que puede haber variaciones de secuencia menores dentro de las secuencias utilizadas o descritas en la presente solicitud. Es bien conocido en la técnica que algunas secuencias de ADN dentro de un tramo mayor de secuencia son más importantes que otras para determinar la funcionalidad. Un experto en la técnica puede probar las variaciones permitidas en la secuencia, sin experimentación indebida, mediante técnicas mutagénicas bien conocidas que incluyen, pero no se limitan a, las discutidas por D. Shortle et al. (1981) Ann. Rev. Genet. 15: 265 M. Smith (1985) ibíd. 19: 423 D. Botstein y D.Shortle (1985) Science 229: 1193 mediante mutagénesis de escaneo de enlazador (S. McKnight y R. Kingsbury (1982) Science 217: 316) o mediante mutagénesis de saturación (R. Myers y col. (1986) Science 232: 613). Estas variaciones pueden determinarse mediante técnicas estándar en combinación con métodos de ensayo descritos en el presente documento para permitir a los expertos en la técnica manipular y poner en uso las unidades funcionales de los promotores polII, genes estructurales y promotores subgenómicos. Usando los métodos descritos en el presente documento, el experto en la técnica puede, sin experimentación indebida, probar secuencias alteradas dentro de un promotor subgenómico para la retención de la función. Los pasos finales de la realización preferida para obtener tejido vegetal modificado genéticamente incluyen insertar el complejo de expresión en un vector que contiene ADN-T y transferir el ADN recombinante al tejido vegetal en el que el ADN-T modificado se integra de manera estable como parte del genoma. . Pueden emplearse otras técnicas para transformar células vegetales, que incluyen transformación de protoplastos, electroporación, microinyección y agroinfección.

      Los siguientes ejemplos se proporcionan únicamente con fines ilustrativos y no pretenden limitar el alcance de la invención. Los ejemplos utilizan muchas técnicas bien conocidas y accesibles para los expertos en las artes de la biología molecular, en la manipulación de ADN recombinante en tejido vegetal y en el cultivo y regeneración de plantas transformadas. Las técnicas para manipulaciones similares de ADN recombinante en células animales y bacterianas son bien conocidas. Las enzimas se obtienen de fuentes comerciales y se usan de acuerdo con las recomendaciones de los proveedores u otras variaciones conocidas en la técnica. También se conocen en la técnica reactivos, tampones y condiciones de cultivo. Las referencias que contienen procedimientos de biología molecular estándar incluyen T. Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, Nueva York R. Wu (ed.) (1979) Meth. Enzymol. 68 R. Wu y col. (eds.) (1983) Methods Enzymol. 100 y 101 L. Grossman y K. Moldave (eds.) Methods Enzymol. (1980) 65 J. Miller (ed.) (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Old and Primrose (1981) Principles of Gene Manipulation, University of California Press, Berkeley, Calif. R Schlief y P. Wensink (1982) Métodos prácticos en biología molecular, Springer-Verlaz Berlin Glover (ed.) (1985) DNA Cloning, Vols. I y II, IRL Press, Oxford, Reino Unido B. Hames y S. Higgins (eds.) (1985) Hibridación de ácidos nucleicos, IRL Press, Oxford, Reino Unido P. Setlow y A. Hollaender (1979) Ingeniería genética: principios y métodos , Vols. 1 a 4, Plenum Press, Nueva York. Las abreviaturas y la nomenclatura, cuando se emplean, se consideran estándar en el campo y se usan comúnmente en revistas profesionales como las que se citan en este documento.

      Este ejemplo describe las moléculas de ADN recombinante y las estrategias de clonación utilizadas para caracterizar las secuencias promotoras subgenómicas de BMV.

      1.1 Clones de ADNc de tipo salvaje del virus del mosaico de Brome en plásmidos de vectores de transcripción

      Los plásmidos pB1TP3, pB2TP5 y pB3TP8 contienen copias de ADNc de los ARN 1, 2 y 3 del BMV, respectivamente, a partir de los cuales se pueden producir transcripciones infecciosas, protegidas y debidamente iniciadas del genoma completo del BMV con la ARN polimerasa T7 (M. Janda et al. (1987) Virol. 158: 259). Otros plásmidos usados ​​en la construcción de derivados de RNA3 fueron pB3TP7 (M. Janda et al. (1987) y pB3PM1 (P. Ahlquist y M. Janda (1984) Mol. Cell. Biol. 4: 2876-2882). Esos plásmidos contienen la misma región de ADNc de BMV que pB3TP8, pero están unidas a un promotor T7 con un solo residuo G intermedio, y directamente unidos a un promotor de E. coli, respectivamente. Todos los plásmidos anteriores, excepto pB3M1, son derivados de pUC119 y, por lo tanto, contienen la replicación del ssDNA origen del bacteriófago M13, lo que permite la recuperación de formas de ssDNA después de la superinfección con fagos auxiliares adecuados, como M13K07 (proporcionado por J. Vieira).

      1.2 Construcciones de plásmidos con construcciones de BMV mutantes

      Se utilizaron métodos estándar con modificaciones menores (T. Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, Nueva York). Para unir los extremos no complementarios de los fragmentos producidos por diferentes endonucleasas de restricción, los extremos 3 'que sobresalen se recortaron hasta volverlos romos con la ADN polimerasa T4, y los extremos 3' empotrados se extendieron hasta los extremos romos con el fragmento grande de la ADN polimerasa I de E. coli o la ADN polimerasa T4 .

      pB3IC4: Se transformó E. coli RZ1032 (dut, ung) (T. Kunkel (1985) Proc. Nat. Acad. Sci. USA 82: 488) con pB3TP8 y se aisló ADNss que contenía dUTP después de la superinfección con M13K07. Este ADN se utilizó como molde para la mutagénesis dirigida por oligonucleótidos (Kunkel, 1985) para eliminar 17 de los 18 residuos del tracto oligo (A) intercistrónico pB3TP8, y los clones del producto se seleccionaron mediante secuenciación de didesoxinucleótidos (M. Biggen et al. (1983) Proc. Nat. Acad. Sci. USA 80: 3963). El oligonucleótido mutagénico utilizado fue d (GACATAGATCTAATAATAAC). Se retuvo un único residuo A del oligo (A) para preservar el sitio BglII en el límite 5 'del promotor central. pB3IC4 es el plásmido que carece del tracto oligo (A) en la región promotora subgenómica.

      pB3SG5, 5R, 9, 10, 11, 13, 14, 15, 21, 22: Se insertaron copias del fragmento AvaI-SacI de pB3TP7 como duplicaciones en los sitios indicados de la región de ADNc de ARN3 de pB3TP7: pB3SG5: XbaI pB3SG7: ClaI pB3SG9: ClaI, XbaI pB3SG10: XbaI, StuI pB3SG13 ClaI, XbaI, StuI pB3SG14: NsiI, XbaI, StuI. Se usó análisis de restricción para seleccionar aquellas inserciones con la misma orientación que el ADNc circundante. Se requirieron múltiples rondas de clonación para construir esos derivados con múltiples inserciones del fragmento de promotor subgenómico. En los casos de construcciones de promotores múltiples, el uso del fragmento AvaI-SacI en lugar del fragmento AvaI-SalI más pequeño permitió la distinción de las especies de ARN subgenómico resultantes diferenciables en tamaño mediante electroforesis en gel.

      pB3SG5R contiene el fragmento AvaI-SaCI en la orientación inversa en el sitio XbaI de pB3TP7.

      pB3SG11 contiene el fragmento AvaI-SalI como una duplicación en el sitio XbaI de pB3TP7. De manera similar, pB3SG15, pB3SG21 y p322 contienen los fragmentos BglII-SalI, BsXI-SalI y DdeI-SalI, respectivamente.

      pB3SG6, 6R: pB3BB1 es un derivado de pB3TP7 en el que se ha introducido una deleción de la base 1168 al sitio SacI cadena abajo (R. A. French y P. Ahlquist), (1987) J. Virol. 61: 1457). El fragmento AvaI-SacI de pB3TP8 se introdujo en el sitio XbaI de pB3BB1 en la misma orientación que el ADNc circundante para crear pB3SG6, y en la orientación inversa para crear pB3SG6R.

      pB3IC2, 3, 5, 6: en construcciones separadas, se insertó un enlazador BamHI (CGCGGATCCGCG, New England Biolabs) en los sitios AvaI y BglII de pB3M1 después de rellenar los extremos rebajados con la ADN polimerasa de Klenow. El pequeño fragmento PstI-BamHI de cada uno de estos plásmidos se ligó con el gran fragmento PstI-BamHI de pB3BC1 (French y Ahlquist, 1987) para producir plásmidos intermedios con las duplicaciones de ADNc de pB3IC2 y pB3IC3 respectivamente. El pequeño fragmento PstI-ClaI de cada plásmido se intercambió luego por el pequeño fragmento PstI-ClaI de pB3TP8 (para sustituir un promotor de bacteriófago T7 por el promotor de E-coli para la transcripción in vitro) para producir pB3IC2 y pB3IC3. En dos construcciones adicionales, el fragmento grande EcoRI-HincII de pB3HS1 (French y Ahlquist, 1987) se ligó con el pequeño fragmento AvaI-EcoRI de pB3TP8 o pB3IC4. Los fragmentos BglII-EcoRI grandes de los plásmidos resultantes se ligaron individualmente con el fragmento BamHI-EcoRI pequeño de pB3BC1 para producir pB3IC5 y pB3IC6, respectivamente.

      Transcripción in vitro, inoculaciones de protoplastos y análisis de ARN

      Este ejemplo describe las técnicas utilizadas para examinar la funcionalidad de las secuencias promotoras subgenómicas de tipo salvaje o alteradas de BMV.

      Los protoplastos de cebada se aislaron como se describe (L. Loesch-Fries y T. Hall (1980) J. Gen. Virol. 47: 323). La transcripción in vitro en presencia de m7GpppG o GpppG, inoculación e incubación de protoplastos, extracción y análisis de ARN viral y densitometría de las autorradiografías resultantes se llevaron a cabo como se describe (French y Ahlquist, 1987). Cada construcción de plásmido se probó en al menos tres experimentos independientes. Las sondas para la cadena (+) de ARN fueron un transcrito de SP6 marcado con 32P del subclon pB3HE1, que contiene el fragmento HindIII-EcoRI de 200 bases de las secuencias de ADNc de ARN3 3 'terminales de pB3TP8, o en ciertos experimentos (Figura 6 de MS) a transcrito in vitro similar complementario a la región BglII-SacII de RNA3. Se llevó a cabo una electroforesis en gel desnaturalizante para el análisis de ARN de cadena negativa en genes de formaldehído (Maniatis et al., 1982). Las sondas para los ARN de cadena negativa fueron transcripciones in vitro de subclones que cubren la región AvaI-SacI de BMV RNA3.

      Se llevaron a cabo experimentos de extensión de cebadores después de la inoculación de 106 protoplastos con transcripciones de clones de ADNc de ARN1 y ARN2 (pB1TP3 y pB2TP5) y transcripciones del clon de ADNc de ARN3 apropiado. Después de la incubación durante 24 h bajo luz continua, los ácidos nucleicos totales se aislaron y se disolvieron en 15 µl de ddH2O. Se mezclaron 1,5 μl de este ácido nucleico con 1 ng de d marcado con 5'-32P (GCGAGTCATCTTACC) (complementario a las bases 28-42 de BMV RNA4) en un volumen total de 4 μl con 1,5 unidades de transcriptasa inversa (Life Sciences, Inc .) desoxinucleótidos a 25 μM cada uno, y concentraciones finales de Tris-Cl 25 mM pH 8,3, MgCl 5 mM2, KCl 25 mM y DTT 5 mM. Después de la incubación durante 30 min. a 37ºC, los productos se desnaturalizaron a 95ºC durante 3 min. en un volumen igual de formamida al 90%, EDTA 20 mM, xilencianol al 0,1%, azul de bromofenol al 0,1% y alícuotas de 3 µl se sometieron a electroforesis en un gel de poliacrilamida al 12%, urea 8,3M. Los carriles de marcadores se prepararon de manera similar excepto que cada reacción contenía 50 µM de un solo desoxinucleótido, y el molde fue ssDNA preparado a partir de partículas de fago aisladas después de la superinfección de E. coli transformada con pB3SG6 con el fago auxiliar M13K07. Las comparaciones de secuencias se realizaron con la ayuda de software del Grupo de Computación Genética de la Universidad de Wisconsin.

      Construcción de pB3-SGP y expresión génica

      Este ejemplo describe la construcción de un derivado de cDNA RNA3 que dirige la expresión de la actividad cloranfenicol acetil transferasa (CAT) bajo el control de transcripción del promotor subgenómico del BMV, donde la expresión del complejo promotor subgenómico-gen CAT es de un sitio nuevo en el Molécula de ARN3.

      El complejo promotor subgenómico-gen CAT se clona como un fragmento AvaI-PstI de pB3CA42 (R. French y col. (1986) Science 231: 1294). Después de llenar los extremos de una sola hebra con la ADN polimerasa de Klenow, este fragmento se clona en el sitio XbaI de pB3TP7 después de un tratamiento similar para crear extremos enrasados ​​en el plásmido resultante en el que la orientación del complejo promotor subgenómico-gen CAT es la misma que en el ADNc circundante se denomina pB3-SGP.

      Los transcritos de ARN se introducen en protoplastos de cebada como se describe en el Ejemplo 2. La actividad del gen CAT se mide como se describe en French et al., 1986.

      Construcción de pBMVSGP y expresión génica de dos etapas controlada por la BMV

      Este ejemplo describe la construcción de una molécula de ADN recombinante que contiene el promotor subgenómico de BMV y el gen bacteriano cloranfenicol acetiltransferasa (CAT), de manera que la expresión del gen CAT está bajo el control regulador del promotor subgenómico. Esta molécula puede usarse para reducir el gen CAT dependiente del promotor subgenómico de BMV en tejido vegetal por cualquier medio conocido en la técnica. El tratamiento del tejido vegetal modificado genéticamente mediante el tratamiento con ARN genómicos de BMV para suministrar actividad ARN polimerasa dependiente de ARN activa entonces la expresión del gen CAT bajo el control del promotor subgenómico.

      El fragmento AvaI-PstI de pB3CA42 (R. French y col. (1986) Science 231: 1294) proporciona la combinación de promotor subgenómico-gen CAT. Después de reparar todos los salientes monocatenarios con ADN polimerasa de Klenow, este fragmento se inserta en el sitio BamHI de pGA355 + 26 (G. An y col. (1986) Mol. Gen. Genet. 203: 245). Se realizan digestiones con endonucleasas de restricción para elegir el producto en el que el extremo PstI es adyacente al promotor nos, un promotor polII este recombinante es pBMVSGP. Por tanto, una transcripción primaria dirigida por el promotor nos será una cadena (-) con respecto al promotor subgenómico y la región codificante de CAT. No hay un sitio de inicio de la traducción en la parte derivada de nos de la transcripción primaria.

      El pBMVSGP se introduce en protoplastos de tabaco usando la técnica de electroporación (M. Fromm y col. (1985) Proc. Natl. Acad. Sci. 82: 5824). Las transcripciones de la cadena primaria (-) serán sintetizadas constitutivamente por la ARN polimerasa II celular.

      La expresión de CAT dependiente del promotor subgenómico se logra mediante la introducción de ARN de BMV como fuente de actividad de ARN polimerasa dependiente de ARN en los protoplastos de tabaco modificados genéticamente, como describen L. Loesch-Fries et al. (1985) Virology 143: 626. La actividad enzimática de CAT se mide como se describe (French et al. (1986)).


      Las partículas subgenómicas satélites son reguladores clave del ciclo de vida del virus adenoasociado

      Históricamente, las partículas interferentes defectuosas (DI) de AAV se conocían como viriones anormales que surgen de errores naturales de replicación y encapsidación. A través del análisis del genoma de un solo virión, revelamos que una categoría principal de partículas DI contiene un genoma de ADN de doble hebra en una configuración "snapback" (SBG). Los 5'-SBG incluyen los promotores P5 y las secuencias del gen rep parcial. Los 3'-SBG contienen la región de la cápside. La configuración molecular de los 5'-SBG permitió la transcripción de ARN bicatenario en su configuración dímera, que a su vez regula la expresión de rep de AAV y puede mejorar el empaquetamiento de AAV. Por el contrario, los 3'-SBG en su configuración de dímero aumentaron los niveles de proteína cap. La generación y acumulación de 5'-SBG y 3'-SBG parece estar coordinada para equilibrar el nivel de expresión génica viral. Por lo tanto, las funciones de 5'-SBG y 3'-SBG pueden ayudar a maximizar el rendimiento de las progenies de AAV. Postulamos que la población de virus AAV se comportó como una colonia y utiliza sus partículas subgenómicas para superar el límite de tamaño del genoma viral y codifica funciones esenciales adicionales.


      Ver el vídeo: 5 pasos de un buen promotor (Diciembre 2022).