Información

Western Blot: ¿Sustrato Fischer ECL 2: 1 en lugar de 1: 1?

Western Blot: ¿Sustrato Fischer ECL 2: 1 en lugar de 1: 1?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Recientemente desarrollé una membrana PVDF-WB incubada con b-actina-ab con el kit Thermo Scientific Pierce ECL. De acuerdo con los pedidos de los fabricantes, mezclé el Reactivo 1 y el Reactivo 2 1: 1. Pero desafortunadamente tengo bandas "desequilibradas" (en el lado derecho de la imagen). Entonces alguien me dio el consejo de intentar mezclar los reactivos 2: 1. Para este sustrato obtuve el resultado en el lado izquierdo, que en realidad se ve mucho mejor. ¿Alguno de ustedes ha tenido la misma experiencia y alguien puede explicarme por qué es así? ¿Es "legal" hacerlo o altera de alguna manera los resultados de mi experimento?

Tuyo, p1ssn3lk3


Bueno, generalmente en un kit de ECL, uno de los reactivos es el sustrato y el otro es el peróxido de hidrógeno, que activa el sustrato para su descomposición usando el HRP en su anticuerpo secundario (Ab), por lo que realmente dudo que lo que está viendo sea el resultado de diferencia de relación. Para llegar a esa conclusión, debe analizar sus muestras dos veces (en dos membranas separadas) y hacer un ECL 1: 1 y 2: 1 y si observó tal diferencia, entonces tiene bases más firmes.

Sospecho que lo que ha sucedido en el experimento anterior es que ha hecho un 1: 1 (con 1Ab y 2Ab no distribuidos equitativamente en la membrana) y luego, quizás, después de un lavado no muy completo, ha realizado otra incubación de 1Ab y 2Ab usando el a Mezcla 2: 1. Sospecho que lo que ha sucedido es que en tu 1: 1 el lado izquierdo no ha recibido muy bien las mezclas de Ab y cuando hiciste el 2: 1 ya que la mano derecha todavía Ab adherida a él (si no quitaste la membrana ) por lo que el lado izquierdo fue "forzado" a obtener los Abs, por lo tanto, nuevamente la mezcla de Ab y ECL no se unieron por igual. Es obvio, ya que una imagen está opuesta a la otra, por lo que es el paso de incubación de Ab el que ha fallado. De lo contrario, si ha realizado la segunda mezcla de incubación ECL inmediatamente después de la primera y no realizó un paso de lavado, puede ocurrir lo mismo si la membrana no recibió la mezcla ECL inicial por igual, ya que puede obtener un efecto de bloqueo con la mezcla ECL anterior. y quizás lo que ha sucedido es que el H2O2 o el sustrato estuvo presente en exceso en el segundo paso de incubación amplificando así la señal en las secciones de la membrana que no recibieron muy bien la mezcla ECL en primer lugar, en relación con el resto de la membrana, que todavía tiene líquido ECL del último experimento (nuevamente, si no ha lavado bien la membrana, la ECL puede estar activa hasta por 24 horas en algunos kits, pero después de unas horas la actividad generalmente se reduce pero aún puede ser observado)

Lo que hay que hacer es después de la ECL, lavar la membrana con TBST durante unos minutos seguido de TBS, dejar secar la membrana al sol para que el Ab se desnaturalice lentamente (aunque eso no siempre sucede especialmente con Abs de alta afinidad como como anti-tubulina y actina). Después de al menos 24 horas, retire la membrana de Ab y vuelva a realizar la incubación de Ab. Lo mejor que puede hacer es hacer todos los pasos de incubación en una bolsa sellada, luego asegurarse de que la membrana reciba la mezcla ECL por igual y hacer la visualización. Sin embargo, diría que, dado que la membrana está desigualmente "contaminada" con los Abs, lo mejor que puede hacer es volver a realizar la ejecución experimental y volver a ejecutar el gel. Es una molestia, ¡pero necesitas llegar al botón de esto!


Tuve un problema similar. En mi caso, me di cuenta de que es absolutamente esencial lavar la membrana en TBS sin Tween (TBS, no TBST) antes de usar ECL. Si tiene alguna cantidad de jabón (Tween) en su membrana, reacciona de alguna manera con la ECL y cada vez debería tener un patrón diferente de estas manchas. Lavar la membrana en TBS y luego incubar con ECL marcó la diferencia para mí y solucionó el problema.


Intente enjuagar la mancha en TBS o PBS antes de tratar. Agítelo y colóquelo en una superficie seca y nivelada. Cuando vierto el reactivo de quimioterapia a allí, solo vierto lo suficiente para que la tensión superficial mantenga el líquido en el papel y no permita que se escurra.

Otras posibilidades que veo podrían estar en tu transferencia. La temperatura no puede ser uniforme en el búfer.


RESULTADOS

La lisina 2-hidroxiisobutirilación se distribuye ampliamente en los hongos patógenos de las plantas.

Para investigar si alguna de las PTM identificadas recientemente existe en hongos patógenos de plantas, realizamos una transferencia de Western para detectar KC.A, succinilación (Ksuc), benzoilación (Kben), crotonilación (Kcro) y Khib modificaciones en U. virens utilizando pan-anticuerpos específicos. Observamos bandas correspondientes a proteínas que contienen estas modificaciones en un amplio rango de masa proteica (Figura 1A). Los PTMs Ksuc, Kben, Kcroy Khib eran todos muy abundantes en U. virens, mientras que KC.A fue el menos abundante.

Detección y perfil de lisina 2-hidroxiisobutirilación (Khib) en Ustilaginoidea virens

(A) Análisis de Western blot de KC.A, Ksuc, Kben, Kcroy Khib en U. virens. La proteína se extrajo utilizando el método de precipitación con TCA-acetona. El gel de electroforesis en gel de poliacrilamida de dodecilsulfato de sodio (SDS-PAGE) se tiñó con Coomassie Brilliant Blue (CBB) como control de carga. (B) Análisis de Western blot de Khib en U. virens, Magnaporthe oryzae, Fusarium graminearum, Sclerotinia sclerotiorum, Rhizoctonia solani, y Colletotrichum higginsianum. La proteína se extrajo con tampón de lisis. (C) Descripción esquemática del flujo de trabajo experimental para la identificación de Khib en U. virens. (D) Diagramas de Venn de Khib sitios (proteínas) en U. virens identificado a partir de 7 días de micelios cultivados y muestras de flores de arroz infectadas 6 días después de la infección. (mi) Análisis estadístico de significativamente regulado al alza (cambio de veces & gt1.5, PAG & lt 0.05) y regulado a la baja (cambio de pliegue & gt1.5, PAG & lt 0.05) Khib sitios de U. virens en muestras infectadas frente a micelios cultivados. (F) Distribución de proteínas 2-hidroxiisobutiriladas en función del número de sitios modificados.

Para evaluar si el Khib existe modificación en otros hongos fitopatógenos, realizamos inmunotransferencia con un Khib pan-anticuerpo en Magnaporthe oryzae (hongo del añublo del arroz), Fusarium graminearum (Hongo del tizón de la cabeza de Fusarium), Sclerotinia sclerotiorum (Hongo de pudrición por Sclerotinia), Rhizoctonia solani (hongo del tizón de la vaina del arroz), y Colletotrichum higginsianum (hongo de antracnosis crucífero). Khib se detectó en estos patógenos fúngicos (Figura 1B), lo que demuestra que Khib se distribuye ampliamente en hongos fitopatógenos.

Identificación de sitios 2-hidroxiisobutirilados de lisina en U. virens

Para identificar Khib sitios en U. virens, realizamos un análisis sistemático de Khib mediante la combinación de las técnicas de enriquecimiento por afinidad y proteómica utilizando las proteínas aisladas de micelio cultivado 7 d y tejido de flor de arroz infectado a los 6 d posteriores a la inoculación (dpi) (Figura 1C). En total, se identificaron 6 170 péptidos 2-hidroxiisobutirilados que abarcaban 3 426 sitios de 977 proteínas con & lt1% de tasa de descubrimiento falso (FDR), de los cuales 2 884 sitios en 849 proteínas tenían información cuantitativa (Tabla S1). Los sitios 2-hidroxiisobutirilados identificados en micelios cultivados en líquido fueron similares a los identificados en muestras de flores de arroz infectadas. Solo seis sitios 2-hidroxiisobutirilados en micelios no se detectaron en muestras de flores de arroz infectadas (Figura 1D). Entre los K cuantificableshib sitios en todas las muestras, 568 sitios en 313 proteínas de U. virens mostró un aumento en los tejidos vegetales infectados (cambio de veces & gt1.5, PAG & lt 0.05), mientras que 50 sitios en 38 proteínas fueron regulados negativamente (Figura 1E). Además, para determinar la distribución de sitios 2-hidroxiisobutirilados dentro de proteínas individuales, calculamos el número de sitios de modificación por proteína, determinando que 425 proteínas modificadas tenían solo un sitio 2-hidroxiisobutirilado, mientras que 552 proteínas albergaban dos o más sitios de modificación (Figura 1F ). Entre las proteínas con dos o más sitios de modificación, 51 proteínas estaban muy modificadas y tenían más de 102 sitios 2-hidroxiisobutirilados. Las cuatro principales proteínas más 2-hidroxiisobutiriladas fueron la metionina sintasa independiente de cobalamina (Uv8b_5222), la proteína de choque térmico 70 (UV8b_555), el factor de alargamiento 2 (Uv8b_5927) y la disulfuro-isomerasa (Uv8b_5623) (Tabla S1). Además, 458 de las 977 proteínas 2-hidroxiisobutiriladas se anotaron como enzimas. Entre las 458 enzimas 2-hidroxiisobutiriladas, 248 tenían múltiples Khib sitios y 38 fueron muy modificados (más de 10 Khib sitios) (Tabla S2). Por tanto, concluimos que Khib es un PTM común y complejo en U. virens.

Análisis de sitios 2-hidroxiisobutirilados de lisina

Para determinar si existen motivos de secuencia común en Khib péptidos, alineamos las secuencias de aminoácidos que rodean a Khib sitios contra todos U. virens secuencias de fondo (Figuras 2A, S1). Según la prueba exacta de Fisher, la alanina (A) estaba drásticamente sobrerrepresentada en las posiciones -4, 3, +1 y +4 (PAG & lt 0,05). El glutamato (G) se enriqueció en las posiciones -2, -1 y +3, mientras que la lisina (K) se enriqueció en las posiciones -10 a -5 y +8 (PAG & lt 0,05). También identificamos 28 Khib sitios en histonas, como en las colas N-terminales de H3 (K23, K27 y K36) y H4 (K12 y K31) (Figura 2B). Muchos sitios de H2A y H2B fueron 2-hidroxiisobutirilados en U. virens (Figura 2B) incluso en el extremo N-terminal, el dominio globular y el extremo C-terminal de las histonas centrales. Por lo tanto, estos resultados revelaron valores comunes y variados de Khib sitios en histonas de U. virens.

Caracterización de la lisina 2-hidroxiisobutirilación (Khib) proteoma en Ustilaginoidea virens

(A) El logotipo de la secuencia de consenso muestra una secuencia representativa para todos los Khib sitios. El tamaño de un aminoácido refleja la diferencia en la frecuencia de un aminoácido en el experimento y su frecuencia en el conjunto de referencia. los PAGEl valor de cada aminoácido en cada posición se calculó probando la frecuencia experimental contra la frecuencia de cada aminoácido en el conjunto de referencia con la prueba exacta de Fisher. En este logotipo, solo los aminoácidos significativos (PAG & lt 0.05). (B) Un diagrama que muestra los sitios de histona Khib identificado en este estudio.

Anotación funcional de proteínas 2-hidroxiisobutiriladas

Para comprender mejor la función potencial de Khib en U. virens, investigamos la clasificación funcional de Gene Ontology (GO) de todas las proteínas 2-hidroxiisobutiriladas (Tabla S3). El análisis de enriquecimiento para procesos biológicos demostró que las proteínas 2-hidroxiisobutiriladas estaban asociadas con varios procesos metabólicos, procesos biosintéticos, respiración y transporte de hidrógeno (Figura 3A). Dentro del grupo de la función molecular, la mayoría de las proteínas 2-hidroxiisobutiriladas se asociaron con un componente estructural molecular de los ribosomas, la actividad portadora de electrones o participaron en la actividad enzimática (Figura 3A). En la clasificación de los componentes celulares, las proteínas 2-hidroxiisobutiriladas se distribuyeron principalmente en el citoplasma, la parte citoplasmática, los orgánulos no delimitados por la membrana y los ribosomas (Figura 3A).

Anotación funcional de proteínas 2-hidroxiisobutiriladas en Ustilaginoidea virens

(A) Análisis de procesos biológicos, funciones moleculares y componentes celulares de la lisina 2-hidroxiisobutirilación (Khib) proteínas. (B) Análisis de enriquecimiento de la vía de la enciclopedia de genes y genomas de Kioto (KEGG) de Khib proteínas. Todos los caminos con PAGSe muestran -valor & lt0.05. (C) Predicciones de localización subcelular de la Khib proteínas.

Explorar las posibles vías afectadas por Khib, realizamos un análisis de enriquecimiento de la vía de la enciclopedia de genes y genomas de Kioto (KEGG) de la Khib proteínas (Tabla S4). Múltiples vías metabólicas centrales, que incluyen ribosoma, metabolismo del carbono, ciclo de TCA, glucólisis / gluconeogénesis y vías de metabolismo del piruvato, se enriquecieron significativamente (Figura 3B). Una gran proporción de enzimas metabólicas en la vía de las pentosas fosfato, el ciclo del TCA y la glucólisis / gluconeogénesis fueron 2-hidroxiisobutiriladas, incluidas las enzimas glucosa-6-fosfato isomerasa (PGI), 6-fosfofructoquinasa (PFK) dependiente de ATP, fosfoglicerato quinasa 1 (PGK1), enolasa (ENO1) y otros (Figura S2).

El análisis de localización subcelular con WoLF PSORT predijo que entre los 977 Khib-proteínas modificadas, la mayoría se ubicaron en el citoplasma (31%), mitocondrias (27%) o núcleo (21%) (Figura 3C). Esta diversidad de localizaciones subcelulares destaca que, además de las proteínas histonas en el núcleo, otras proteínas no histonas en varios orgánulos fueron modificadas con Khib, que está de acuerdo con el análisis de enriquecimiento del proceso biológico.

Redes de interacción de proteínas 2-hidroxiisobutiriladas

Determinar la correlación de proteínas 2-hidroxiisobutiriladas entre sí en U. virens, generamos una red de interacción de proteínas de todos los Khib-proteínas reguladas basadas en la base de datos STRING. Las 977 proteínas modificadas formaron una red de proteínas altamente interconectada. Posteriormente, el análisis MCODE demostró que todas las proteínas 2-hidroxiisobutiriladas estaban estrechamente conectadas. Como se muestra en la Figura S3, varios complejos y funciones celulares formaron grupos prominentes y altamente conectados, incluido el complejo proteico ribosómico y el proteasoma. Había algunas proteínas 2-hidroxiisobutiriladas relacionadas con la virulencia y la respuesta al estrés, incluidos los componentes estructurales del ribosoma, los factores de iniciación de la traducción, las proteínas de la vía de la proteína quinasa activada por mitógenos (MAPK), las proteínas relacionadas con la autofagia y las septinas (Figura 4A-E). Estos resultados destacan a los candidatos para la caracterización funcional futura de los roles potenciales para Khib en importantes procesos biológicos de U. virens.

Redes de interacción de proteínas 2-hidroxiisobutiriladas en Ustilaginoidea virens

(A) Setenta y cinco proteínas asociadas a ribosomas. (B) Doce proteínas asociadas con la vía de la proteína quinasa activada por mitógenos (MAPK). (C) Ocho proteínas asociadas con factores de iniciación de la traducción. (D) Cuatro proteínas asociadas con septinas. (mi) Diez proteínas asociadas a la autofagia.

Se requiere UvRpd3 para eliminar Khib in vitro y en vivoy virulencia de U. virens

los S. cerevisiae Se informó anteriormente que las histonas desacetilasas Rpd3p y Hos3p tienen actividad de des-2-hidroxiisobutirilación (Huang et al., 2017). La alineación de la secuencia de aminoácidos reveló que UvRpd3 y UvHos3 eran ortólogos de S. cerevisiae Rpd3p y Hos3p con alta identidad (75% y 64%, respectivamente). Todos contienen el mismo dominio, Hist_deacetyl, y las secuencias de proteínas de la región del dominio compartido eran muy similares (Figura S4A-C). Para investigar si los homólogos de Rpd3p y Hos3p en U. virens podría regular Khib, noqueamos UvRpd3 y UvHos3 en U. virens (Figura S5A, B) y analizó el UvRpd3 y UvHos3 mutantes de deleción (∆UvRpd3 y ∆UvHos3, respectivamente) a través de inmunotransferencias con anti-Khib anticuerpos. En UvHos3 mutantes de deleción, sin cambios en Khib Se detectaron niveles entre los mutantes de deleción y la cepa de tipo salvaje (Figura 5A). Sin embargo, en el UvRpd3 mutantes de deleción observamos aumentos en Khib y KC.A sobre los niveles de tipo salvaje (Figura 5A, B). Para explorar más este resultado, expresamos UvRpd3 o UvHos3 en Escherichia coli y obtuvo proteínas UvRpd3 y UvHos3 purificadas. En in vitro experimentos de actividad enzimática, Khib Los niveles disminuyeron en muchas bandas de proteínas en el tratamiento con Rpd3-GST (glutatión-S-transferasa), mientras que Khib los niveles no cambiaron en el tratamiento con Hos3-GST (Figura 5C), lo que sugiere que UvRpd3 funciona como una enzima de desmodificación para eliminar la 2-hidroxiisobutirilación. Para investigar si UvRpd3 funciones en U. virens infección, realizamos ensayos de virulencia utilizando UvRpd3 mutantes de deleción en arroz susceptible cv. Wanxian-98. Después de 21 dpi, en comparación con el tipo salvaje y la cepa de complementación, el ∆UvRpd3 los mutantes produjeron bolas de carbón falso significativamente reducidas en las espiguillas (Figura 5D, E). Estos resultados demostraron que UvRpd3 es importante para Khib eliminación y virulencia de U. virens.

UvRpd3 tiene actividad de-2-hidroxiisobutirilasa

(A) Lisina 2-hidroxiisobutirilación (Khib) niveles en UvRpd3 y UvHos3 Los mutantes por deleción y el tipo salvaje (WT) se detectaron mediante inmunotransferencia. Se muestran dos réplicas de cada inmunotransferencia usando pan anti-Khib anticuerpos. (B) KC.A niveles en el UvRpd3 mutante de deleción y el WT se detectaron mediante inmunotransferencia. Se muestran dos réplicas para cada inmunotransferencia usando pan anti-KC.A anticuerpos. (C) In vitro Des-2-hidroxiisobutirilación de lisina (Khib) actividad de UvRpd3 y UvHos3 mediante ensayos de transferencia Western. Se muestran dos réplicas para cada inmunotransferencia usando pan anti-Khib anticuerpos. (D) Virulencia del WT, UvRpd3 mutantes de deleción y la cepa de complementación a los 21 días posteriores a la infección en arroz cv. Wanxian-98. (mi) Número medio de bolas de carbón por panícula. Se recopilaron datos de tres experimentos independientes para cada tratamiento y se analizaron mediante la prueba de diferencia mínima significativa (LSD) de Fisher. Los asteriscos representan diferencias significativas entre los mutantes y el WT por LSD en PAG = 0.05.

La mutación de los sitios de 2-hidroxiisobutirilación en MAPK UvSlt2 provocó una reducción de la virulencia fúngica y la actividad enzimática de UvSlt2

En organismos eucariotas, la vía de señalización MAPK media las respuestas a señales fisiológicas y ambientales. En los hongos patógenos filamentosos, las vías Pmk1-MAPK y Slt2-MAPK tienen funciones conservadas en la patogénesis, mientras que la vía Hog1-MAPK juega un papel específico de la especie en la patogénesis. Para explorar más a fondo el papel de la 2-hidroxiisobutirilación de proteínas en la virulencia de hongos fitopatógenos, realizamos mutagénesis dirigida al sitio de los sitios de 2-hidroxiisobutirilación en UvSlt2, que se identificó como una supuesta proteína 2-hidroxiisobutirilada. Identificamos dos sitios de 2-hidroxiisobutirilación en UvSlt2, ubicados en K53 y K60 (Figuras 6A, B, S6).Para validar estos sitios, se generaron los mutantes puntuales de UvSlt2 UvSlt2 K53R, UvSlt2 K60R y UvSlt2 K53R / K60R, en los que las lisinas de los sitios de 2-hidroxiisobutirilación se mutaron a arginina (K-R). Tipo salvaje UvSlt2 y K-R mutado UvSlt2 Las construcciones se fusionaron con el gen de la proteína verde fluorescente (GFP) y se expresaron en el ∆UvSlt2-2 mutante. La transferencia Western de la fracción enriquecida en 2-hidroxiisobutirilación confirmó que la 2-hidroxiisobutirilación de UvSlt2 se vio seriamente interrumpida por estas mutaciones, pero las mutaciones puntuales de UvSlt2 no afectaron su propio nivel de modificación de acetilación (Figura 6C), lo que confirma que UvSlt2 es de hecho el 2 -proteína hidroxiisobutirilada modificada en estos sitios.

UvSlt2 es una proteína 2-hidroxiisobutirilada

(A, B) Espectro de espectrometría de masas en tándem de en vivo 2-hidroxiisobutirilación de lisina (Khib) sitios de UvSlt2. (C) La Khib y KC.A Los niveles de UvSlt2-GFP recombinante purificada, UvSlt2 K53R -GFP, UvSlt2 K60R -GFP y UvSlt2 K53R / K60R -GFP se determinaron mediante transferencia de Western usando pan anti-Khib y anti-KC.A anticuerpos. Las bandas de las señales de la proteína se cuantificaron utilizando el software ImageJ (v1.6.0_24). (D) Western blot reveló que UvRpd3 puede catalizar la des-2-hidroxiisobutirilación y desacetilación de UvSlt2. (mi) Ensayo de coinmunoprecipitación. Transferencia de Western de proteínas totales y proteínas eliminadas usando agarosa anti-Flag de transformantes que coexpresan construcciones UvSlt2-GFP y UvRpd3-Flag o una construcción única detectada con anticuerpos policlonales anti-GFP y anti-Flag. (F) Virulencia del tipo salvaje (WT), UvSlt2 mutantes de deleción, la cepa de complementación y los mutantes puntuales UvSlt2 K53R, UvSlt2 K60R y UvSlt2 K53R / K60R a los 21 días posteriores a la infección en arroz cv. Wanxian-98. (GRAMO) Número medio de bolas de carbón por panícula de las plantas en (F). (H) La 2-hidroxiisobutirilación de K53 y K60 afectó la actividad enzimática de UvSlt2. Detección de la actividad de las cepas WT, UvSlt2-1, UvSlt2 K53R -1, UvSlt2 K60R -1 y UvSlt2 K53R / K60R -1. Se recopilaron datos de tres experimentos independientes para cada tratamiento y se analizaron mediante la prueba de diferencia mínima significativa (LSD) de Fisher. Los asteriscos representan diferencias significativas entre los mutantes y el WT por LSD en PAG = 0.05.

Para probar si UvRpd3 puede eliminar la acetilación y la 2-hidroxiisobutirilación de UvSlt2, realizamos in vitro experimentos sobre UvSlt2 purificado. Observamos que UvRpd3 podría eliminar tanto la acetilación como la 2-hidroxiisobutirilación de UvSlt2 (Figura 6D). Además, un ensayo de co-inmunoprecipitación (Co-IP) confirmó que UvRpd3 interactuaba con UvSlt2 (Figura 6E). Estos resultados indican que UvRpd3 interactúa con UvSlt2 para eliminar la 2-hidroxiisobutirilación y acetilación de UvSlt2.

Para estudiar el efecto de la 2-hidroxiisobutirilación sobre las funciones biológicas de UvSlt2, comparamos la virulencia entre los U. virens tipo salvaje, UvSlt2 mutantes de deleción (ΔUvSlt2-1 y ΔUvSlt2-2), la cepa de complementación (CΔUvSlt2-2), la cepa UvSlt2-GFP (UvSlt2-1), las cepas de mutación de un solo punto (UvSlt2 K53R -1, UvSlt2 K53R -2, UvSlt2 K60R -1 y UvSlt2 K60R -2) y las cepas de mutación de doble punto (UvSlt2 K53R / K60R -1 y UvSlt2 K53R / K60R -2). Todas las cepas de UvSlt2 2-hidroxiisobutirilación deficientes (K-R) mostraron una virulencia reducida en comparación con la de las cepas de tipo salvaje y UvSlt2-1 (Figura 6F, G). Además, las cepas de UvSlt2 2-hidroxiisobutirilación deficientes (K-R) eran parcialmente defectuosas en la conidiación, pero no en el crecimiento micelial (Figura S7). Para determinar por qué la 2-hidroxiisobutirilación de UvSlt2 puede afectar la virulencia de U. virens, medimos la actividad enzimática de las proteínas UvSlt2 mutadas K-R. Todas las proteínas mutadas UvSlt2 K-R mostraron una actividad enzimática significativamente disminuida (Figura 6H), lo que implica que Khib moduló la actividad enzimática de UvSlt2. Por tanto, las funciones de UvSlt2 pueden controlarse mediante 2-hidroxiisobutirilación mediante la autorregulación de su actividad enzimática.

Simulaciones de dinámica molecular de UvSlt2

Para obtener información sobre los posibles mecanismos por los cuales la 2-hidroxiisobutirilación podría afectar la actividad enzimática de UvSlt2, utilizamos simulaciones de dinámica molecular (MD) para determinar cómo la 2-hidroxiisobutirilación de K53 y K60 influye en la estructura de UvSlt2. Cuando los residuos de lisina en las posiciones 53 y 60 se mutaron a R, las estructuras de la proteína eran casi las mismas que la estructura de UvSlt2 sin modificar (Figura 7A-D). Las simulaciones MD del 2-hidroxiisobutirilado UvSlt2 (K53hib, K60hib, K53hib/ K60hib) indicó que la 2-hidroxiisobutirilación de K53 y K60 resultó en estructuras que eran casi idénticas a la UvSlt2 sin modificar (Figura 7E-G). Las estructuras del UvSlt2 2-hidroxiisobutirilado (K53hib, K60hib, K53hib/ K60hib) y los mutantes K-R UvSlt2 (K53R, K60R y K53R / K60R) fueron casi idénticos al UvSlt2 sin modificar durante todo el curso de las simulaciones (Figura 7H, I). Las simulaciones revelaron que los mutantes y el UvSlt2 no modificado compartían estructuras secundarias similares y solo experimentaron cambios menores desde el inicio hasta el estado final. Sin embargo, las estructuras secundarias de UvSlt2 2-hidroxiisobutirilado (K53hib, K60hib, K53hib/ K60hib) fueron notablemente diferentes de los de UvSlt2 sin modificar (Figura 7J). Debido a la perturbación de las estructuras secundarias y las fluctuaciones conformacionales, las estructuras de UvSlt2 2-hidroxiisobutirilado tenían una fuerte tendencia a formar un área superficial hidrófoba accesible al solvente (Figura 7K, L). Cuando K se transformó en R, el área superficial accesible al disolvente hidrófobo no cambió. Es importante destacar que después de la 2-hidroxiisobutirilación de UvSlt2, el área superficial accesible al disolvente hidrófobo aumentó y, por lo tanto, afectó la unión entre la enzima UvSlt2 y sus sustratos.

Modelado estructural de UvSlt2

(A) Estructura final de las simulaciones de UvSlt2 no 2-hidroxiisobutirilado. (B) Estructura final de las simulaciones de UvSlt2 K53R. (C) Estructura final de las simulaciones de UvSlt2 K60R. (D) Estructura final de las simulaciones de UvSlt2 K53R / K60R. (mi) Estructura final de las simulaciones de UvSlt2 2-hidroxiisobutirilado en K53. (F) Estructura final de las simulaciones de UvSlt2 2-hidroxiisobutirilado en K60. (GRAMO) Estructura final de las simulaciones de UvSlt2 2-hidroxiisobutirilado en K53 y K60. (H, I) Análisis de las desviaciones cuadráticas medias (RMSD), fluctuaciones cuadráticas medias (RMSF) y radio de giro (Rgs) para los diferentes sistemas UvSlt2. (Arriba) Trayectorias de las RMSD generales de los diferentes sistemas UvSlt2. (Medio) Radio de los perfiles de giro de los diferentes sistemas UvSlt2. (Abajo) Perfiles RMSF específicos de residuos de los diferentes sistemas UvSlt2. (J) Evolución de la estructura secundaria de UvSlt2 y sus mutantes. La evolución de la estructura secundaria en cada fotograma se controló utilizando el algoritmo del diccionario de estructura secundaria de proteínas (DSSP). En las franjas, cada píxel representa la estructura secundaria (codificada por colores) de un residuo (40–70, X-dimensión) en un momento dado en la simulación (y-dimensión). (K, L) Evolución temporal del área de la superficie accesible al solvente (SAS) calculada para los diferentes sistemas que fueron simulados.


Protocolos

Guías de protocolo fáciles de seguir para anticuerpos Proteintech.

Protocolos específicos del producto

Protocolos específicos del producto directamente desde nuestro cuaderno de laboratorio al suyo.

Ahora puede encontrar protocolos detallados adaptados a anticuerpos individuales en el catálogo de Proteintech. Los protocolos se optimizan individualmente para cada anticuerpo para ayudarlo a lograr los mejores resultados posibles.

Cómo acceder a los protocolos específicos del producto

Navegue hasta el menú de soporte y haga clic en 'Protocolos específicos del producto'

Busque su anticuerpo elegido por nombre o número de catálogo en la barra de búsqueda de Proteintech.

Seleccione 'Ver' junto a su anticuerpo elegido.

Elija su PDF de protocolo específico del producto entre una variedad de aplicaciones de anticuerpos.

Alternativamente, puede encontrar protocolos específicos de productos en la pestaña 'Protocolos' en cada página de productos de anticuerpos.

ELISA

Introducción a ELISA

El ensayo inmunoabsorbente ligado a enzimas (ELISA) se usa ampliamente en inmunología para detectar la presencia de proteínas u otros anticuerpos en una muestra. Por ejemplo, se utiliza como herramienta de detección inicial del VIH, basada en la interacción de un anticuerpo con el antígeno presentado por el virus. Hay varios métodos ELISA diferentes: ELISA indirecto, ELISA sándwich y ELISA competitivo son los más comúnmente aplicados. Los tres métodos tienen pasos similares:

1) Adjuntar antígenos o anticuerpos primarios o sus complejos a una superficie sólida.

2) Lave las sustancias no unidas.

3) Bloquear los sitios expuestos en la superficie sólida.

4) Agregue anticuerpos de detección y / o anticuerpos secundarios conjugados con enzimas.

5) Desarrolle el color agregando sustratos que reaccionen con las enzimas.

Descargas

Protocolo PDF descargable ELISA indirecto

Presentación de diapositivas de consejos técnicos y básicos de ELISA

Inmunohistoquímica

Introducción a la inmunohistoquímica

La inmunohistoquímica (IHC) le permite visualizar proteínas en el tejido sin perder su microestructura. Ayuda a demostrar la posición exacta y la distribución de la proteína de interés en la sección de tejido analizada. La ventaja de esta visualización es que permite comparar, por ejemplo, tejidos sanos y enfermos. Brevemente, en un experimento de IHC, el antígeno de interés se localiza mediante la unión de un anticuerpo. La interacción anticuerpo-antígeno se visualiza posteriormente mediante detección cromogénica o fluorescente.

El protocolo IHC contiene muchos pasos que pueden requerir optimización para garantizar la unión de anticuerpos específicos y una visualización óptima de la proteína objetivo. Dado que el protocolo IHC contiene muchos factores variables diferentes, puede resultar complicado encontrar las mejores condiciones de trabajo para obtener una tinción fuerte y específica.

Protocolo IHC paso a paso
Inmunohistoquímica utilizando secciones de parafina montadas en portaobjetos

Todos los pasos del siguiente protocolo se llevan a cabo a temperatura ambiente a menos que se indique lo contrario. Las recetas de todas las soluciones resaltadas en negrita se incluyen al final del protocolo.

Sumerja los portaobjetos en xileno durante 10 minutos. Repita este paso nuevamente en xileno nuevo durante 10 minutos. (Si es necesario, repita una tercera vez en xileno nuevo durante otros 10 minutos).

Rehidrate las secciones incubando secuencialmente con etanol al 100%, 95%, 80% y 60% durante 5 minutos cada una.

Enjuague las secciones con agua destilada tres veces durante 3 minutos cada una.

Transfiera los portaobjetos a un recipiente apto para microondas y cúbralos con Tampón de citrato o Tampón Tris-EDTA (TE).

Calentar en el microondas a potencia media durante 10 minutos.

Deje que los portaobjetos se enfríen en el tampón citrato o tampón Tris-EDTA (TE) durante aproximadamente 35 minutos.

Enjuague los portaobjetos tres veces con 1x TBST durante 3 minutos cada uno.

Incubar los portaobjetos con una solución de H2O2 al 3% (diluida en agua destilada) durante 10 minutos para apagar la actividad de peroxidasa endógena.

Enjuague los portaobjetos tres veces con 1x TBST durante 3 minutos cada uno, luego enjuague los portaobjetos tres veces con agua destilada durante 3 minutos cada uno.

Prepare suero de bloqueo normal al 5% en 1x TBST. El suero debe provenir de la misma especie en la que se generó el anticuerpo secundario. Bloquea las secciones durante 1 hora. (Alternativamente, use 5% de BSA en 1x TBST para bloquear si el suero correspondiente no está disponible).

Incubar secciones con anticuerpo primario diluido en 1x TBST durante 1 hora, o durante la noche a 4 ° C, la proporción óptima de dilución de anticuerpos debe predeterminarse mediante experimentación. Configure los controles negativos omitiendo el paso de incubación del anticuerpo primario para un portaobjetos por cada condición experimental.

Después de la incubación del anticuerpo primario, enjuague los portaobjetos tres veces con 1x TBST durante 3 minutos cada uno.

Aplique suficiente polímero marcado con peroxidasa e incube durante 30 minutos.

Enjuague los portaobjetos tres veces con 1x TBST durante 3 minutos cada uno.

Prepare un volumen apropiado de solución de sustrato antes de usar mezclando una gota de Liquid DAB más cromógeno inmediatamente con 1 ml de tampón de sustrato.

Aplicar el sustrato con cuidado e incubar durante 5 a 10 minutos hasta que se desarrolle un color marrón.

Enjuague las secciones suavemente con suficiente agua destilada.

Para teñir los núcleos, sumerja los portaobjetos en un baño de hematoxilina durante 3 minutos.

Enjuague los portaobjetos suavemente con agua destilada.

Transfiera los portaobjetos a una solución de etanol al 99% de HCl al 1% durante 10 segundos y transfiéralos a agua destilada inmediatamente.

Sumerja los portaobjetos secuencialmente en baños de etanol al 60%, 80%, 95% y 100% durante 5 minutos cada uno.

Sumerja los portaobjetos en xileno durante 5 minutos. Repita este paso nuevamente en xileno nuevo durante 5 minutos.

Monte la sección con suficiente material de montaje y cúbrala con un cubreobjetos.

Deje secar al aire en un área bien ventilada (por ejemplo, campana extractora).

Soluciones

Descargas

Cómo optimizar su experimento de inmunohistoquímica La guía completa

IHC utilizando secciones de parafina montadas en portaobjetos Protocolo PDF descargable

IHC: sección congelada frente a sección de parafina Protocolo PDF descargable

Inmunofluorescencia

Introducción a la inmunofluorescencia

La tinción por inmunofluorescencia (IF) es una técnica ampliamente utilizada en la investigación biológica y el diagnóstico clínico. IF utiliza anticuerpos marcados con fluorescencia para detectar antígenos diana específicos. Seguido de imágenes, es una técnica muy directa ya que puede visualizar los resultados. Aunque es una herramienta bien establecida, se deben considerar múltiples factores y se deben tomar varios pasos de optimización para asegurar una tinción exitosa.

Protocolo IF paso a paso
Inmunotinción de células cultivadas

Todos los pasos de este protocolo se realizan a temperatura ambiente a menos que se indique lo contrario. Para una tinción óptima, las incubaciones deben realizarse en un agitador rotatorio de movimiento lento, a menos que la línea celular que se utilice sea delicada (por ejemplo, células neuronales). Las recetas de las soluciones resaltadas en negrita se proporcionan siguiendo el protocolo.

Aspirar el medio, lavar las células sembradas en cubreobjetos de vidrio limpios brevemente con 1X PBS.

Fijar las células con paraformaldehído al 4% recién preparado en 1X PBS durante 10 minutos.

Enjuague los cubreobjetos con 1X PBS 3 veces durante 3 minutos cada uno.

Permeabilizar con Triton X-100 al 0,2% preparado en 1X PBS durante 5 minutos. Enjuague los cubreobjetos 3 veces con 1X PBS durante 3 minutos cada uno.

Aspire la solución de bloqueo y aplique el anticuerpo primario diluido en tampón de dilución de anticuerpos. Ponga a un lado una condición experimental de cubreobjetos para un control negativo e incube en tampón de dilución de anticuerpos menos el anticuerpo primario. Deje estas incubaciones durante 1 hora o, alternativamente, incube durante la noche a 4 ° C.

Tenga en cuenta: Si incuba durante la noche, tome medidas para asegurarse de que los cubreobjetos no se sequen.

Lave los cubreobjetos con 1X PBS 3 veces durante 3 minutos cada uno.

Aplique un anticuerpo secundario conjugado con fluoróforo apropiado diluido en tampón de dilución de anticuerpos a los cubreobjetos e incube durante 1 hora en un ambiente oscuro y húmedo.

Nota: Es imperativo que los cubreobjetos se mantengan en condiciones de oscuridad tanto como sea posible después de la adición de reactivos fluorescentes.

Lave los cubreobjetos con 1X PBS 3 veces durante 3 minutos cada uno.

Monte los cubreobjetos en los portaobjetos de microscopio con Hydromount (National Diagnostics) que contiene DAPI (si lo desea) para la tinción nuclear.

Examine los portaobjetos con un microscopio de fluorescencia.

Soluciones
1X PBS En 1000 ml (volumen final)
Na₂HPO₄ 10 mM 1,42 g
1,8 mM KH₂PO₄ 0,24 g
NaCl 137 mM 8 g
KCl 2,7 mM 0,2 g
Ajustar a pH 7,4
Agregue ddH₂O a 1000 ml
Tampón de dilución de anticuerpos En 20 ml (volumen final)
1% BSA 0,2 g
Agregue 1X PBS a 20ml

Descargas

La guía completa para optimizar la tinción por inmunofluorescencia Protocolos generales, consejos técnicos y preguntas frecuentes

Células cultivadas de inmunotinción PDF descargable

Inmunoprecipitación

Introducción a la inmunoprecipitación

La inmunoprecipitación (IP) es una técnica de purificación por afinidad. IP purifica un antígeno utilizando un anticuerpo específico que está inmovilizado en una matriz sólida. La IP es uno de los métodos más utilizados para el aislamiento de proteínas a partir de lisados ​​de células o tejidos.

Protocolo IP paso a paso

Mantenga las muestras lo más frías posible siguiendo los pasos a continuación en hielo o en una habitación fría a 4 ° C. Las recetas de todas las soluciones resaltadas en negrita se incluyen al final del protocolo.

  • Las células se pueden lisar usando cualquier protocolo de lisis celular estándar compatible con su material de partida. Consulte “Preparación de lisados ​​de células y tejidos” para conocer los protocolos de lisis recomendados por Proteintech.

Consejo 1: Las altas concentraciones de detergentes interfieren con la inmunoprecipitación (IP). Lyse las células con un volumen de tampón de lisis RIPA tan pequeño como sea posible antes de diluir los lisados ​​con 1x PBS hasta el volumen final deseado.

Consejo 2: Use suficiente lisado: para cada IP intente usar entre 1 y 3 mg de proteína total. Los lisados ​​de 0,2 a 0,5 ml, que contienen un total de 1 a 3 mg de proteína, son ideales para un solo IP. Mida la cantidad total de proteína mediante un ensayo de proteínas, como el ensayo de Bradford o BCA.

Consejo 3: Asegúrese de que haya inhibidores de proteasa en el tampón de lisado. La concentración de inhibidor de proteasa debe ser de 1,5 a 2 veces mayor que la de un protocolo típico de preparación de lisados ​​para transferencia Western.

  • Resuspenda la suspensión de perlas de proteína A o G sefarosa agitando suavemente la botella de almacenamiento. Añada rápidamente 50 μl de suspensión de microesferas al 50% por 0,5 a 1 mg de proteína total al tubo de microcentrífuga que contiene el lisado.

Consejo 4: Corte con cuidado el extremo de la punta de la pipeta en un ángulo de 45 ° con una cuchilla afilada para facilitar el pipeteo de la suspensión de perlas. Para mantener la succión, solo es necesario quitar una sección muy pequeña de la punta de la pipeta.

  • Incubar en un mezclador rotatorio durante 30 minutos a 4 ° C.
  • Centrifugar a 1000 rpm durante 3 minutos a 4 ° C y transferir el sobrenadante a un tubo nuevo.

Consejo 5: Se recomienda el aclarado previo con perlas de proteína A o sefarosa G para tejidos con abundancia de IgG.

Agregue una cantidad adecuada (1 a 4 μg) de anticuerpo primario al lisado completo (o aclarado previamente). La concentración óptima de anticuerpos debe determinarse mediante titulación. Configure un experimento de control negativo con IgG de control (correspondiente a la fuente primaria de anticuerpos). Agite suavemente las incubaciones a 4 ° C durante 2-4 ho durante la noche.

Agregue 50 l de suspensión de perlas de proteína A o G sefarosa para capturar el inmunocomplejo. Agite suavemente la mezcla a 4 ° C durante 1 a 4 h.

Centrifugar la mezcla IP a 1000 rpm durante 30 segundos a 4 ° C y desechar el sobrenadante.

Lave las perlas de 3 a 4 veces con 1 ml de TBST 1x con inhibidor de proteasa 1x, centrifugue y deseche el sobrenadante como en el paso 6. Conserve aproximadamente 80μl de sobrenadante después de la última centrifugación.

Vuelva a suspender el pellet con 20μl 5x Tampón de muestra SDS, agite suavemente durante varios segundos.Calentar a 95–100ºC durante 5 min y centrifugar a 10.000 g X g (aproximadamente 9700 rpm para rotores de un radio de 9,5 cm) durante 3 minutos.

Cargue los sobrenadantes en un gel SDS-PAGE; alternativamente, transfiera el sobrenadante con cuidado a un tubo de microcentrífuga nuevo y bien etiquetado y almacénelo a -80 ° C para su uso posterior. (Para el método 2, almacene directamente a -80 ° C para su uso posterior).

Separe los IP mediante SDS-PAGE y transfiera las proteínas a la membrana PVDF. Sonda con los anticuerpos adecuados.

Consejo 6: Para la detección de proteínas inmunoprecipitadas mediante transferencia Western, sin o con detección reducida de artefactos no específicos (como las cadenas pesada y ligera del anticuerpo inmunoprecipitado), detecte anticuerpos primarios utilizando anticuerpo específico de cadena ligera (L) anticonejo conjugado con HRP y Proteína A conjugada con HRP en lugar de los anticuerpos secundarios conjugados con HRP tradicionales. (La proteína A tiene una mayor afinidad por los anticuerpos intactos en comparación con los anticuerpos desnaturalizados).


Estos autores contribuyeron igualmente: Kelvin F. Cho, Tess C. Branon.

Afiliaciones

Programa de Biología del Cáncer, Universidad de Stanford, Stanford, CA, EE. UU.

Departamento de Genética, Universidad de Stanford, Stanford, CA, EE. UU.

Kelvin F. Cho y Alice Y. Ting

Departamento de Biología Molecular y Celular, Universidad de California, Berkeley, Berkeley, CA, EE. UU.

Broad Institute of MIT y Harvard, Cambridge, MA, EE. UU.

Namrata D. Udeshi, Samuel A. Myers y Steven A. Carr

Departamento de Biología, Universidad de Stanford, Stanford, CA, EE. UU.

Departamento de Química, Universidad de Stanford, Stanford, CA, EE. UU.

Chan Zuckerberg Biohub, San Francisco, CA, EE. UU.

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

También puede buscar este autor en PubMed Google Scholar

Contribuciones

K.F.C., T.C.B, N.D.U., S.A.M., S.A.C. y A.Y.T. contribuido a la redacción y edición del manuscrito.

Autor correspondiente


Discusión

La 1,25 (OH) 2D3 es un regulador clave de la homeostasis del Ca 2+ a través de la unión a un receptor específico-VDR [38]. Los órganos diana arquetípicos de esta hormona incluyen huesos, intestinos y riñones. De hecho, diversos conjuntos de tejidos que no participan en el metabolismo mineral y óseo poseen VDR específico y responden secuencialmente a la 1,25 (OH) 2D3, incluidos los testículos [13]. Sin embargo, el papel de la 1,25 (OH) 2D3 en la fisiología de los órganos genitourinarios aún se desconoce principalmente. En nuestro estudio, nuestro objetivo fue investigar el papel funcional de la 1,25 (OH) 2D3 en la fisiología del esperma y los mecanismos moleculares a través de los cuales este secosteroide puede afectar la reproducción masculina humana, descubriendo nuevas acciones de la 1,25 (OH) 2D3.

Primero, identificamos VDR en espermatozoides a diferentes niveles: presencia de ARNm, expresión de proteínas y su localización. Informes anteriores que demostraron el tamaño del VDR mediante electroforesis en gel, mostraron que varía dependiendo de la especie estudiada con un peso molecular que va de 50 a 60 kDa. Los testículos humanos mostraron una proteína de 57 y otra de 52 kDa de peso molecular en comparación con 57 y 37 kDa en el testículo de rata [39]. La próstata humana mostró proteína de 52 kDa en comparación con la próstata ventral (57 y 37 kDa) y dorsal de rata (52 y 26 kDa). Nuestros datos sobre isoformas de VDR son superponibles a los encontrados en testículos humanos. Recientemente, en espermatozoides humanos, se informó VDR a un tamaño de 50 kDa [14], y esta discrepancia con nuestros datos puede deberse a diferentes enfoques metodológicos y / o al anticuerpo utilizado. Parece que se expresa una menor cantidad de VDR en muestras patológicas que tienen oligoastenozoospermia grave. La localización de VDR por ensayo de inmunofluorescencia confirmó los datos observados en nuestro estudio anterior, mostrando por análisis inmunológico que VDR estaba localizado en el núcleo del esperma, aunque algunas partículas también decoraban el cuello [15]. En las células somáticas, el complejo receptor-hormona se localiza en el núcleo y luego interactúa con el elemento que responde a 1,25 (OH) 2D3, modificando la transcripción de los genes diana. Además de su acción genómica clásica, los receptores nucleares regulan los procesos celulares a través de un mecanismo no genómico [40]. En general, se acepta que el núcleo del espermatozoide es transcripcionalmente inactivo debido a la arquitectura altamente condensada de su cromatina. En este estudio, investigamos los efectos rápidos del VDR como también hemos observado anteriormente para otros receptores nucleares en el esperma humano [18, 29, 41]. De hecho, este modo de acción parece ser particularmente apropiado en el gameto masculino porque las funciones de los espermatozoides deben activarse rápidamente para adaptarse a los cambios dinámicos en el medio circundante. Es importante destacar que nuestro estudio también evidenció que la 1,25 (OH) 2D3 es una hormona producida localmente ya que el gameto masculino expresa la 1α, hidroxilasa. La presencia de esta proteína en el esperma y el VDR plantea la posibilidad de un ciclo corto autocrino.

La fisiología del esperma depende de señales no genómicas entre las que el Ca2 + tiene un papel importante [42, 43], sin embargo, su regulación es poco conocida. La producción autónoma de 1,25 (OH) 2D3 junto con la presencia de VDR nos llevó a plantear la hipótesis de una regulación autocrina del Ca2 + en los espermatozoides, en base a este papel clásico de la 1,25 (OH) 2D3 a nivel sistémico. Existen evidencias considerables de que existen reservas de Ca 2+ en los espermatozoides de mamíferos y recientemente se demostró que desempeñan un papel importante en el desencadenamiento de la motilidad hiperactivada. De hecho, las reservas internas de Ca 2+ podrían proporcionar suficiente Ca 2+ para la inducción de la hiperactivación, luego se requiere el influjo de Ca 2+ para mantener los niveles intracelulares de Ca 2+ suficientes para maximizar y mantener este proceso que condujo a la reacción del acrosoma [36 ]. De nuestros datos surge que la 1,25 (OH) 2D3, a través del VDR, es capaz de incrementar los niveles de Ca 2+ intracelular, abordando un papel del receptor en la inducción de la motilidad hiperactivada, que a su vez desencadena o contribuye a los cambios espermáticos. asociado a la capacitacin y reaccin acrosomica. Los mecanismos que controlan la interacción entre el equilibrio energético y la reproducción son objeto de intensas investigaciones. Los espermatozoides capacitados muestran un aumento del metabolismo y del gasto energético general, sin embargo, las vías de señalización asociadas con el cambio en la energía del metabolismo de los espermatozoides son poco conocidas. En este estudio, observamos en los espermatozoides que la 1,25 (OH) 2D3, a través del VDR, reduce el contenido de triglicéridos de forma concomitante con el aumento de la actividad de la lipasa. El paso que limita la velocidad en el metabolismo de los lípidos neutros en el tejido adiposo se encuentra en el nivel de la lipasa, que cataliza la hidrólisis de los triglicéridos [44]; previamente se demostró una alta actividad de la lipasa en los espermatozoides [45]. Sin embargo, el sustrato endógeno utilizado para el metabolismo energético de los espermatozoides es específico de la especie y no está claro hasta qué punto los triglicéridos suministran las demandas de energía de los espermatozoides de mamíferos. Particularmente, de nuestro estudio parece que la 1,25 (OH) 2D3 no afecta la β-oxidación de FFA o las actividades de G6PDH y esto puede explicarse por el hecho de que el aumento de la actividad de la lipasa está regulado por Ca 2+ [46] y por lo tanto , este efecto podría ser imputable a la acción calcémica de la 1,25 (OH) 2D3.

Curiosamente, parece que la 1,25 (OH) 2D3 influye de manera diferente en el metabolismo de los lípidos en los adipocitos y en los espermatozoides. En los adipocitos humanos, la 1,25 (OH) 2D3 estimula el influjo de Ca 2+, promueve la lipogénesis e inhibe la lipólisis mediante una rápida acción no genómica [47]. Se demostró que la supresión de 1,25 (OH) 2D3 por un alto contenido de Ca 2+ en la dieta estimula la lipólisis, inhibe la lipogénesis [48] y, por lo tanto, desplaza la distribución de la energía alimentaria del almacenamiento de energía al gasto energético. De manera similar, este efecto 'anti-obesidad' del Ca 2+ puede ocurrir en los espermatozoides durante la capacitación cuando la afluencia de Ca 2+ aumenta fuertemente. Por lo tanto, parece que, a pesar del tejido adiposo, la 1,25 (OH) 2D3 tiene un efecto lipolítico en los espermatozoides, sin embargo, puede existir una intrincada cooperación de factores endocrinos y autocrinos / paracrinos en esta célula que conducen a una fina regulación de la energía. necesario a las diferentes condiciones fisiológicas. El aumento temprano de Ca 2+ libre intracelular de espermatozoides inducido por 1,25 (OH) 2D3 podría estar involucrado en el cambio del metabolismo de la lipogénesis a la lipólisis. De hecho, se puede especular que la 1,25 (OH) 2D3 aumenta la movilización de Ca 2+ intracelular, estimulando la inducción de la capacitación que requiere energía. Por lo tanto, el metabolismo de los lípidos aumenta para satisfacer las demandas energéticas durante el proceso al reducir el almacenamiento de energía y aumentar el gasto energético. Además, el metabolismo de los lípidos de los espermatozoides podría ser más sensible a las variaciones de Ca 2+ dada la importancia de esta señalización en los espermatozoides. De hecho, es importante señalar que el Ca 2+ intracelular es aproximadamente 50-100 nM en espermatozoides no capacitados, 200-1000 nM en espermatozoides hiperactivos [49] y puede aumentar hasta aproximadamente 10 µM durante la reacción del acrosoma [50].

Se ha informado de una amplia gama de respuestas rápidas estimuladas por 1,25 (OH) 2D3 [51]. Se ha demostrado que ERK1 / 2, AKT y GSK3 participan en diferentes actividades de los espermatozoides [18, 21]. En este estudio, la 1,25 (OH) 2D3 induce rápidamente todas estas vías, lo que indica que el VDR está involucrado en varias funciones de los espermatozoides y, por lo tanto, corrobora la importancia fisiológica inesperada de la hormona en el gameto masculino humano.

La concentración de hormonas puede ser crucial para determinar el tipo de respuesta celular. Se observó en diferentes sistemas celulares que el nivel hormonal regula la asociación entre diferentes receptores y efectores de señalización, lo que sugiere que el ensamblaje o desensamblaje de diferentes módulos está involucrado en los efectos desencadenados por concentraciones hormonales bajas y altas [52, 53]. En nuestro estudio, la respuesta a la 1,25 (OH) 2D3 parece ser bifásica con un efecto estimulante a concentraciones más bajas y volverse inhibitoria o ineficaz a niveles más altos. El resultado de la activación de la señalización en función de las diferencias en el nivel de ligando también se demostró recientemente en espermatozoides humanos [15, 18, 21, 29, 41] y una posible explicación se basa en la regulación a la baja de los receptores a concentraciones elevadas de hormonas [54]. La observación de que diferentes niveles hormonales desencadenan diferentes respuestas en los espermatozoides es un ejemplo notable de la pronunciada flexibilidad de esta célula en la capacidad de respuesta a los esteroides.

En conclusión, la fuente local de esperma de 1,25 (OH) 2D3 puede participar con diferentes acciones en la maduración funcional de los espermatozoides. Los datos proporcionados por los experimentos actuales establecen claramente un papel molecular del VDR en la fisiología del esperma y puede considerarse como un modulador novedoso de la capacidad de fertilización del esperma. El VDR está presente en los túbulos seminíferos, en las espermatogonias [12] y en los espermatozoides [14, 15]. Además de las hormonas esteroides sexuales, los reguladores clásicos de la reproducción, la vitamina D también modula los procesos reproductivos en la mujer humana. Después de que los espermatozoides se depositan en la vagina a través de la eyaculación, deben viajar a través del moco cervical hasta el útero y luego hacia la trompa de Falopio antes de que puedan encontrarse con el óvulo. La 1 alfa-hidroxilasa se expresa en tejidos cervicales y uterinos [55, 56]. El epitelio vaginal [57], el cuello uterino, las células endometriales [58] y las células epiteliales de Falopio expresan VDR [59, 12], lo que implica un papel fisiológico de la 1,25 (OH) 2D3 en este contexto. Se informó que la cantidad de 1,25 (OH) 2D3 presente en el líquido folicular es significativamente menor que en el suero concurrente [60]. Estas observaciones también pueden respaldar nuestros resultados con respecto al efecto bifásico de las dosis de 1,25 (OH) 2D3, ya que los niveles hormonales más bajos inducen la mayoría de las actividades de los espermatozoides evaluadas, mientras que las concentraciones más altas parecen ser ineficaces. Sin embargo, es necesario investigar más a fondo la importancia fisiológica y el papel específico de la 1,25 (OH) 2D3 / VDR en ambos gametos.

Tomados en conjunto, nuestros resultados ampliaron el papel de la 1,25 (OH) 2D3 más allá de sus acciones fisiológicas convencionales, mejoraron nuestro conocimiento sobre el esperma humano a nivel molecular y nuestra comprensión de la vía de señalización de la vitamina D, allanando el camino para nuevas oportunidades terapéuticas en el tratamiento de los trastornos de la fertilidad masculina. La modulación del VDR también podría proporcionar un mecanismo por el cual la vitamina D ambiental o dietética puede influir en la capacidad de fertilización de los espermatozoides y, por lo tanto, en la reproducción masculina.


Material y métodos

Preparación de ARN, RNA-Seq, procesamiento de lectura y análisis de datos

El ARN total se aisló de T. brucei en diferentes etapas (1 x 108 células / réplica) utilizando el kit miRNeasy (Qiagen, Alemania) de acuerdo con el protocolo del fabricante. Se realizó un paso adicional de digestión de DNasa1 para garantizar que las muestras no estuvieran contaminadas con ADN genómico. La pureza del ARN se evaluó utilizando el bioanalizador Agilent 2100 (Agilent Technologies, Santa Clara, CA). La preparación de la biblioteca de secuenciación de próxima generación (NGS) se realizó con la preparación de la biblioteca de ARNm específico de la hebra TruSeq con PolyA-Selection siguiendo el protocolo estándar de Illuminas. Se perfilaron las bibliotecas utilizando el kit de ADN de alta sensibilidad en un bioanalizador 2100 y se cuantificaron utilizando el kit de ensayo Qubit dsDNA HS, en un fluorómetro Qubit 2.0 (tecnologías Life). Las bibliotecas se secuenciaron en un Illumina NextSeq 500 en Genomics Core Facility en el Instituto de Biología Molecular, Mainz, Alemania. La medición de RNA-Seq produjo un promedio de 11,1 M de lecturas individuales de 75 nt por muestra. Evaluamos la calidad de las lecturas secuenciadas con fastqc [72] y dupRadar (https://doi.org/10.1186/s12859-016-1276-2). Las secuencias líder empalmadas (CAATATAGTACAGAAACTGTTCTAATAATAGCGTTAGTT) se eliminaron de las lecturas usando cutadapt (https://doi.org/10.14806/ej.17.1.200) y luego se asignaron a la T. brucei 11 cromosomas megabase (Tri TrypDB versión 36) usando STAR versión 2.5.2b (https://doi.org/10.1093/bioinformatics/bts635), lo que permite hasta 2 desajustes, una longitud mínima de intrón de 21 y mantener solo lecturas alineadas de forma única ( en promedio, 75,1% de todas las lecturas). Luego contamos las lecturas por gen usando featureCounts (https://doi.org/10.1093/bioinformatics/btt656) del paquete subread versión 1.5.1 con parámetros predeterminados y usando los modelos genéticos provistos por Tri TrypDB versión 36. Para el análisis de expresión diferencial , usamos R versión 3.4.3 (http://www.R-project.org/) y DESeq2 versión 1.18.1 (https://doi.org/10.1186/s13059-014-0550-8) para normalizar, transformar y modelar los datos. Los recuentos se ajustaron a un modelo lineal generalizado binomial negativo (GLM), y se utilizó la prueba de significación de Wald para determinar los genes expresados ​​diferencialmente entre las muestras de control y de eliminación. Finalmente, los valores de RPKM se calcularon por gen utilizando los valores FPM (recuentos robustos por millón de fragmentos mapeados) normalizados por tamaño de biblioteca de DESeq2. Aplicamos un filtrado independiente automático para evitar probar genes, que eran malos candidatos para expresarse diferencialmente (maximiza el número de PAG valores inferiores a alfa = 0,1). Los ARNm expresados ​​diferencialmente se identificaron utilizando un umbral de Benjamini-Hochberg corregido PAG valores & lt0.05. Los análisis de enriquecimiento de GO se realizaron utilizando las anotaciones de GO Term Tri TrypDB-36_TbruceiLister427_GO.gaf de Tri TrypDB versión 36 y la prueba exacta de Fisher. Para la comparación con los datos del transcriptoma del conjunto de datos previamente publicado de formas procíclicas y metacíclicas de T. brucei [26,31], los respectivos archivos de datos brutos de RNA-Seq se descargaron de SRA (Bioproject PRJNA381952) y se procesaron exactamente como se describe anteriormente para nuestros datos.

Preparación de muestras por espectrometría de masas, medición de MS y análisis de datos proteómicos

T. brucei en diferentes etapas (1 x 108 células / réplica) se lavaron tres veces en 10 ml de solución salina tamponada con fosfato (PBS) y se lisaron en dodecilsulfato de sodio (SDS) al 6%, DTT 300 mM y Tris-HCl 150 mM ( pH 6,8), 30% de glicerol y 0,02% de azul de bromofenol. Las muestras se cargaron en un gel de gradiente NOVEX NuPage 4% -12% (Thermo Fisher Scientific, Waltham, MA), se corrieron durante 10 minutos a 180 V y se tiñeron con Coommassie G250. Se cortó cada carril y los trozos de gel triturados se transfirieron a un tubo Eppendorf para decolorar con etanol al 50% / tampón ABC 50 mM pH 8,0. Las piezas de gel se secaron y posteriormente se redujeron (DTT 10 mM / tampón ABC 50 mM pH 8,0), se alquilaron (yodoacetamida 55 mM / tampón ABC 50 mM pH 8,0) y se digirieron con 1 μg de tripsina durante la noche a 37 ° C. Los péptidos trípticos se eluyeron de los trozos de gel con acetonitrilo puro y se almacenaron en un StageTip [73].

La medición proteómica se realizó en un espectrómetro de masas Q Exactive Plus (Thermo Fisher Scientific, Waltham, MA) con una columna capilar empaquetada con C18 montada en línea (New Objective, Woburn, MA) eluyendo a lo largo de un gradiente de 225 minutos del 2% a acetonitrilo al 40% usando un sistema EasyLC 1000 uHPLC (Thermo Fisher Scientific, Waltham, MA). El espectrómetro de masas se hizo funcionar con un modo de adquisición dependiente de datos (DDA) top10.

El análisis de datos se realizó en MaxQuant [74] versión 1.5.2.8 utilizando la base de datos tritrypDB-43_TbruceiLister427_2018_AnnotatedProteins (16.869 entradas) y configuraciones estándar, excepto para activar la coincidencia entre la función de ejecución y el algoritmo de cuantificación sin etiquetas (LFQ). Los grupos de proteínas marcados como contaminantes, entradas inversas y solo identificados por sitio se eliminaron antes del análisis bioinformático, así como los grupos de proteínas con menos de 2 péptidos (mínimo 1 único). Se extrajo información adicional como nombres de genes y descripciones del encabezado fasta y se adjuntó a los grupos de proteínas individuales. Además, identificamos el mejor ortólogo para Tb927 utilizando el algoritmo inparanoide [75]. La imputación de los valores faltantes se realizó utilizando una distribución beta dentro de los percentiles 0,2 y 2,5 de los valores medidos para las réplicas individuales por separado. El diagrama de PCA se creó usando el paquete R ggbiplot-0.55, el mapa de calor fue producido por el comando heatmap.2 del paquete gplots-3.0.1.1. La agrupación se realizó utilizando la función pamk del paquete fpc-2.2-1 con "usepam" desactivado y un "krange" entre 5 y 9. El algoritmo realiza una partición alrededor de la agrupación de medoides de grandes conjuntos de datos, con el número óptimo de agrupaciones estimado por óptimo ancho medio de la silueta. El enriquecimiento de GO se realizó mediante la prueba exacta de Fisher y PAG los valores se corrigieron mediante el método de Benjamini-Hochberg.

Condiciones de cultivo de tripanosomas y generación de líneas celulares.

T. brucei Las cepas de células PCF 29.13, transgénicas para la ARN polimerasa de T7 y el represor de tetraciclina [76], se cultivaron in vitro a 27 ° C en medio SDM-80 que contenía hemina (7,5 mg / ml) y FBS al 10%.El vector pLew100v5 para la expresión de RBP6 (un amable regalo del Prof. Tschudi) se linealizó con la enzima NotI y se transfectó en la línea celular 29.13. Las células RBP6 OE se adaptaron para crecer en medio SDM-80 que no contenía glucosa y se suplementaron adicionalmente con N-acetil glucosa-amina 50 mM para bloquear la absorción de moléculas de glucosa residuales de FBS al 10%. La inducción de la proteína RBP6 expresada ectópicamente se desencadenó mediante la adición de 10 μg / ml de tetraciclina en el medio. Las densidades de las células se midieron usando el contador de células Z2 (Beckman Coulter, Brea, CA). A lo largo de los análisis, las células se mantuvieron en la fase de crecimiento logarítmico medio exponencial (entre 2 x 10 6 y 1 x 10 7 células / ml). La línea celular RBP6 OE _catalasa se generó usando el plásmido pT7v5 que contiene un C. fasciculata secuencia del ORF de catalasa (gen cCAT Tri TrypDB [67]. El plásmido pT7v5_catalasa se linealizó con NotI y se transfectó en células RBP6 OE. La actividad de la catalasa se detectó mediante una prueba de actividad visual simple. Se resuspendieron un total de 5 × 10 7 parásitos en 100 μL de PBS y se coloca en un portaobjetos microscópico. Un volumen de 20 μL de 3% H2O2 se añadió a las células, se mezcló y se controló visualmente la formación de oxígeno (formación de burbujas).

Aislamiento de vesículas mitocondriales, BNE y PAGE nativa clara de alta resolución

La BNE de las mitocondrias lisadas con dodecilmaltósido, seguida de tinción de actividad en gel, se adaptó de los protocolos publicados [11]. Brevemente, las vesículas mitocondriales de 5 x 108 células se aislaron mediante lisis de células hipotónicas y las mitocondrias se resuspendieron en un tampón (ácido aminocaproico 750 mM, Bis-Tris 50 mM, EDTA 0,5 mM pH 7,0, suplementado con el total libre de EDTA cóctel inhibidor de proteasa [Roche, Basilea, Suiza]) y lisado durante una hora en hielo con 2% de dodecilmaltoside. Las muestras se centrifugaron a 16.000gramo durante 30 minutos y las concentraciones de proteína del lisado aclarado se determinaron mediante un ensayo de BCA. Se mezcló lisado mitocondrial (20 µg) con un colorante de carga (50 mM ACA, 0,5% [p / v] Coomassie Brilliant Blue G-250). Después de la electroforesis (3 horas, 150 V, 4 ° C), los lisados ​​mitocondriales resueltos se transfirieron a una membrana de PVDF y se sondaron con anticuerpos seleccionados, o los geles nativos se usaron directamente para la tinción de la actividad en gel de los complejos respiratorios. La tinción específica del complejo III se logró incubando el gel en tampón de ensayo del complejo III (1 mg / ml de 3,3 'diaminobencidina, fosfato de sodio 50 mM pH 7,4, 75 mg / ml de sacarosa) mediante agitación lenta durante la noche. La tinción del complejo IV se logró utilizando un tampón de reacción (tampón fosfato 50 mM pH 7,4, 1 mg / ml de 3,3'diaminobencidina, 24 U / ml de catalasa, 1 mg / ml de citocromo C, 75 mg / ml de sacarosa) durante la noche. El complejo V se visualizó usando tampón de reacción de ATPasa (Tris-HCl 35 mM pH 8.0, glicina 270 mM, MgSO4, 0,3% [p / v] Pb (NO3)2, ATP 11 mM) para incubación durante la noche mediante agitación lenta. Las muestras mitocondriales para la detección del complejo II se trataron con colorante de carga (Ponceau-S al 0,1%, glicerol al 50%) y se procesaron en geles nativos transparentes de alta resolución con gradiente de 3% a 12% (hrCNE). La tinción específica se consiguió incubando el gel en una solución de tinción: Tris HCl 7,4 5 mM, succinato sódico 20 mM, metasulfato de fenazina 0,2 mM y cloruro de azul de nitrotetrazolio 2,5 mg / ml.

SDS-PAGE y western blot

Las muestras de proteína se separaron en SDS-PAGE, se transfirieron a una membrana de PVDF (Thermo Fisher Scientific, Waltham, MA) y se sondaron con el anticuerpo monoclonal (mAb) o el anticuerpo policlonal (pAb) apropiados. A esto le siguió la incubación con un anticuerpo secundario anti-conejo o anti-ratón conjugado con HRP (1: 2000, BioRad). Las proteínas se visualizaron usando el sistema Pierce ECL en un instrumento ChemiDoc ((BioRad, Hercules, CA)). Se utilizó el patrón de proteína preteñida PageRuler (Fermentas, Vilnius, Lituania) para determinar el tamaño de las bandas detectadas. Se prepararon varios anticuerpos (anti-Rieske, anti-trCOIV, anti-SCoAS, anti-aconitasa y anti-NDUFA) para el propósito de este estudio. Los marcos de lectura abiertos de los genes respectivos sin su señal de localización mitocondrial predicha se clonaron en el mi. coli plásmido de expresión, pSKB3. Las proteínas se sobreexpresaron en BL21 Escherichia coli células y purificadas en condiciones nativas o desnaturalizadas. Los antígenos se enviaron a Davids Biotechnologie (Regensburg, Alemania) para la producción de pAb. Los anticuerpos primarios utilizados en este estudio fueron los siguientes: mAb anti-mitocondrial hsp70 (1: 2,000) [77], pAb anti-RBP6 (1: 5,000, un generoso obsequio del Prof. Tschudi), pAb anti-BARP y GPEET (1 : 2,000, 1: 1,000, respectivamente, un generoso obsequio del Prof. Roditi), mAb AOX (1: 100) (un generoso obsequio del Prof. Chaudhuri), mAb41-PDH (1: 100) [77], pAb anti- Rieske (1: 1,000, producido comercialmente para el propósito de este estudio), pAb trCoIV (1: 1,000, producido comercialmente para el propósito de este estudio), pAb anti-subunidad beta, F1-ATPasa (1: 2,000) [78], pAb anti-SCoAS (1: 1,000, producido comercialmente para el propósito de este estudio), pAb anti-aconitasa (1: 2,000, producido comercialmente para el propósito de este estudio), pAb anti-AAC (1: 2000) [79], anti-SDH1 [80], pAb anti-TbIF1 [39], pAb anti-PiC (1: 500) [79], pAb anti-NDUFA (1: 1000, comercialmente producido para el propósito de este estudio).

Mediciones de ROS celular, ROS mitocondrial y potencial de membrana mitocondrial (Δψm)

Los niveles de ROS celulares y mitocondriales se determinaron utilizando el diacetato de 2 ′, 7′-diclorofluoresceína (H2DCFHDA) y tintes de superóxido mitocondrial rojo MitoSOX (Thermo Fisher Scientific Waltham, MA), respectivamente. Las células en la fase de crecimiento exponencial se trataron con 10 μM de H2DCFHDA o con MitoSOX 5 μM durante 30 minutos a 27 ° C. Se sedimentó un total de 1 x 10 7 células (1300gramo, 10 minutos, TA), se lavó con 1 mL de PBS (pH 7,4), se resuspendió en 2 mL de PBS y se analizó inmediatamente mediante citometría de flujo (Instrumento BD FACS Canto II, BD Biosciences, San José, CA). El ψψm se determinó usando el éster etílico de tetrametilrodamina con tinción roja fluorescente TMRE (Thermo Fisher Scientific Waltham, MA). Las células en la fase de crecimiento exponencial se tiñeron con 60 nM del tinte durante 30 minutos a 27 ° C. Las células se sedimentaron (1300gramo, 10 minutos, TA), se resuspendió en 2 mL de PBS (pH 7,4) y se analizó inmediatamente mediante citometría de flujo (Instrumento BD FACS Canto II). El tratamiento con el protonóforo FCCP (20 µM) se utilizó como control para la despolarización de la membrana mitocondrial. Para evaluar el efecto de oligomicina y KCN sobre ψψm, las células se incubaron con 2,5 ug / ml de oligomicina o 0,5 mM de KCN en presencia de TMRE durante 30 minutos a 27ºC. Para todas las muestras, se recolectaron 10,000 eventos. Los datos se evaluaron utilizando el software BD FACSDiva (BD Biosciences, San Jose, CA).

Medición de Δψm in situ

La estimación del ψψm in situ se realizó espectrofluorométricamente usando el colorante indicador safranina O (Sigma-Aldrich, St. Louis, MO). T. brucei Las células PCF (2 x 107 células / ml) se resuspendieron en un tampón de reacción que contenía lo siguiente: sacarosa 200 mM, HEPES-Na 10 mM (pH 7,0), succinato 2 mM, MgCl 1 mM2y EGTA 1 mM. La reacción se indujo con digitonina (40 µM), mientras que NaCN (1 mM) y FCCP (5 µM) se inyectaron en puntos de tiempo específicos durante todo el ensayo. Se detectaron cambios en la cantidad de fluorescencia a lo largo del tiempo en un lector de microplacas Infinite M200 (TECAN) (excitación = 496 nm emisión = 586 nm). Los valores se normalizaron de acuerdo con la siguiente ecuación: normalizado (EI) = EI - Emin/MImax - Emin (MImin - el valor mínimo para la variable E, Emax - el valor máximo de la variable E).

Medida del consumo de oxígeno

La tasa de consumo de oxígeno se evaluó a 27 ° C usando 2 x 107 células por cámara de oxígrafo Oroboros O2K. La respiración endógena de las células, así como la respiración inducida por el sustrato, se midieron en medio MiR05 (Oroboros, Innsbruck, Austria). Se utilizaron los siguientes sustratos respiratorios: succinato 10 mM, prolina 5 mM o glicerol-3-fosfato 10 mM. La respiración sensible a SHAM se determinó inyectando 250 μM de SHAM, mientras que la respiración sensible a KCN se evaluó con KCN 1 mM. Si fue necesario, las células se permeabilizaron con 4 ug de digitonina (Sigma-Aldrich, St. Louis, MO).

Ensayo de producción de ATP

La producción de ATP se midió como se describe [42]. Brevemente, las fracciones mitocondriales brutas de las células RBP6 OE se obtuvieron mediante extracción con digitonina. La producción de ATP en estas muestras se indujo mediante la adición de 5 mM de los sustratos indicados (succinato, α-cetoglutarato y glicerol 3-fosfato) y ADP 67 µM. Las preparaciones mitocondriales se preincubaron durante 10 minutos en hielo con el inhibidor malonato (6,7 mM) o KCN (1 mM). La concentración de ATP se determinó mediante un luminómetro (Orion II Berthold Detection Systems, Pforzheim, Alemania) utilizando el kit de ensayo de bioluminiscencia de ATP CLS II (Roche Applied Science, Basilea, Suiza).

Ensayo de morfología celular e inmunofluorescencia

Para el ensayo de inmunofluorescencia, las células se trataron primero con ácido disulfónico de batofenantrolina (BPS) 5 mM, un inhibidor de metaloproteasas, para estabilizar las proteínas de superficie 24 horas antes de la recolección [28]. Luego, las células se recolectaron y fijaron en formaldehído al 3,7% / PBS durante 10 minutos a temperatura ambiente. La suspensión celular se aplicó al cubreobjetos revestido con polilisina (Sigma-Aldrich, St. Louis, MO). Luego, los cubreobjetos se incubaron con pAb primario anti-prociclina (1: 400) y anti-BARP (1: 400) seguido de incubación con anticuerpo secundario de cabra anti-conejo conjugado con Alexa Fluor 488. Para detectar células metacíclicas, las células inducidas por RBP6 (5 × 10 6) se resuspendieron en 80 μL de medio y se suplementaron con 20 μL de Dextran, Alexa Fluor 568 10,000 Mw (Thermo Fisher Scientific Waltham, MA). Después de 1 hora, las células se fijaron con formaldehído, se aplicó al cubreobjetos revestido con polilisina. A continuación, los cubreobjetos se montaron en un portaobjetos de vidrio con ProLong Gold Antifade Mountant (Thermo Fisher Scientific Waltham, MA). Las imágenes se tomaron con el microscopio fluorescente (microscopio universal de imágenes Axioplan 2, Zeiss, Oberkochen, Alemania) con una cámara CCD (Olympus DP73). Para determinar las células por su morfología, se contaron 100 células y se asignaron a un determinado tipo de célula en función de su tamaño, forma, posición del cinetoplasto en relación con el núcleo y posición del cinetoplasto en relación con el extremo posterior de la célula (Datos S1 ).

Análisis de citometría de flujo

Las 2 x 107 células se trataron con BPS 5 mM, se recolectaron (1,500gramo, 10 minutos, TA) y se resuspendió en 200 μL de 1 × PBS pH 7,4. Las células se fijaron mediante la adición de formaldehído al 7,4% en 1 x PBS pH 7,4 durante 15 minutos a TA. Posteriormente, las células se lavaron 3 veces en 1 × PBS, se marcaron con anti-BARP policlonal de conejo (1: 400) y anti-prociclina (1: 400) en BSA al 1% durante 1 hora a TA, seguido de tinción con Alexa Fluor. 488-anticuerpo α-conejo de cabra conjugado (1: 400) en BSA al 1%. A continuación, las muestras se lavaron, se resuspendieron en 1 ml de 1 x PBS pH 7,4 y se analizaron mediante citometría de flujo. Los datos se evaluaron utilizando el software BD FACSDiva.

Análisis metabolómico LC-MS

Para el análisis metabolómico LC-MS, la extracción de la muestra se realizó como se describió anteriormente [81,82]. Brevemente, se utilizaron 5 x 10 7 células para cada muestra. Las células se enfriaron rápidamente en un baño de hielo seco / etanol a 4 ° C, se centrifugaron a 1300gramo, 4ºC durante 10 minutos, se lavó con 1 x PBS y se resuspendió en disolvente de extracción (cloroformo: metanol: agua, relación en volumen 1: 3: 1). Después de agitar durante 1 hora a 4 ° C, las muestras se centrifugaron a 16.000gramo a 4 ° C durante 10 minutos, y el sobrenadante se recogió y almacenó a -80 ° C. El análisis se realizó mediante separación en 150 × 4,6 mm ZIC-pHILIC (Merck, Kenilworth, NJ) en Dionex UltiMate 3000 RSLC (Thermo Fisher Scientific Waltham, MA) seguido de detección de masas en un espectrómetro de masas Orbitrap Fusion (Thermo Fisher Scientific Waltham, MA) en Glasgow Polyomics.

Análisis estadístico

El número de réplicas, controles y pruebas estadísticas está de acuerdo con estudios publicados que emplean técnicas comparables y son generalmente aceptados en el campo. Las diferencias estadísticas se analizaron con el software Prism (versión 8.2.1, software GraphPad). Las comparaciones de dos grupos se calcularon con pares de dos colas t prueba. A PAG un valor inferior a 0,05 se consideró estadísticamente significativo. Se realizaron experimentos de espectrometría de masas cuantitativa en cuatro réplicas biológicas.


Western Blot: ¿Sustrato Fischer ECL 2: 1 en lugar de 1: 1? - biología

Alexander L. Nielsen, /> a Nima Rajabi, & # 8225 a Norio Kudo, B Kathrine Lund & # 248, /> C Carlos Moreno-Yruela, /> a Michael B & # 230k, /> a Martín Fontenas, a Alessia Lucidi, a Andreas S. Madsen, & # 167 a Minoru Yoshida B y Christian A. Olsen /> * a

a Centro de Productos Biofarmacéuticos y Departamento de Diseño de Fármacos y Farmacología, Facultad de Ciencias Médicas y de la Salud, Universidad de Copenhague, Universitetsparken 2, Copenhague, Dinamarca
Correo electrónico: [email protected]

b Centro RIKEN para la ciencia de los recursos sostenibles (S13), Hirosawa 2-1, Wako, Saitama 351-0198, Japón

c Centro de la Fundación Novo Nordisk para la Investigación Metabólica Básica, Facultad de Ciencias Médicas y de la Salud, Universidad de Copenhague, Blegdamsvej 3B, Copenhague, Dinamarca

Abstracto

La sirtuina 2 (SIRT2) es una enzima de proteína desacilasa que elimina los grupos acetilo y los grupos acilo de cadena más larga de los residuos de lisina modificados postraduccionalmente. Afecta a diversas funciones biológicas en la célula y se ha considerado un objetivo farmacológico en relación tanto con las enfermedades neurodegenerativas como con el cáncer. Por lo tanto, el acceso a compuestos de herramientas robustos y bien caracterizados es esencial para la investigación continua de las funciones complejas de esta enzima. Aquí, presentamos una colección de sondas químicas que son potentes, selectivas, estables en suero, solubles en agua e inhiben la desacetilación y desmiristoilación mediada por SIRT2 en las células. En comparación con el panorama actual de los inhibidores SIRT2, este es un conjunto único de características integradas en un solo compuesto. Esperamos que los quimiotipos desarrollados encuentren una amplia aplicación en el interrogatorio de las funciones de SIRT2 tanto en células sanas como enfermas, y que proporcionen una base para el desarrollo de terapias futuras.


Información de soporte

S1 Fig. Gba1b los mutantes tienen un aumento notable de glucosilceramida y una disminución moderada de ceramida.

Lipidómica dirigida en cabezas de mosca de Gba1b mutantes y controlesnorte = 3 réplicas biológicas). Las barras de error representan SD. (A) Niveles de glucosilceramida (GluCer) en relación con los estándares internos, por miligramo de proteína de la cabeza. (B) Niveles de ceramida (Cer) 12: 0 en relación con los patrones internos, por miligramo de proteína de cabeza. *pag & lt 0.05 por estudiante t prueba.

S2 Fig. Proteínas asociadas a EV y no EV con un recambio significativamente más rápido en bizcocho, ROSA1, y Sod2 mutantes.

Las proteínas asociadas a EV no tienen una mayor prevalencia de recambio más rápido en ninguno de los tres mutantes en comparación con sus respectivos controles (pag & gt 0,05 mediante la prueba exacta de Fisher). Todas las mediciones se realizaron en extractos de cabeza de mosca.

S3 Fig. Rab11 expresado exógenamente, como el Rab11 nativo, es más abundante en vehículos eléctricos de Gba1b mutantes en comparación con los controles.

Conductor panneuronal elav-GAL4 se utilizó para expresar Rab11-GFP en Gba1b mutantes y controles. Se sondaron homogeneizados de mosca entera y pequeñas vesículas extracelulares aisladas (sEV, véase Materiales y métodos) con un anticuerpo contra Rab11. (A) Imagen representativa de western blot que muestra Rab11 nativo (flecha) y marcado con GFP (punta de flecha). (B) Cuantificación de Rab11-GFP. Se realizaron al menos tres experimentos independientes. Las barras de error representan SEM. *pag & lt 0,05.

S4 Fig. La eliminación de Ref (2) P confirma la identidad de las formas de alto peso molecular de la proteína.

El omnipresente Act5C-GAL4 El controlador se utilizó para expresar RNAi contra Ref (2) P en Gba1b mutantes. Se sondaron homogeneizados de cuerpo entero con un antisuero contra Ref (2) P. Se muestra una mancha representativa. El control de carga es la tinción Ponceau-S. Se realizaron al menos tres experimentos independientes.

S5 Fig. Minos alelo de inserción de Gba1b tiene los mismos fenotipos bioquímicos que el alelo de deleción.

(A) Imagen representativa y cuantificación de proteína ubiquitinada insoluble. La transferencia Western se realizó en fracciones insolubles en Triton de cabezas de moscas de control de 10 días de edad (Gba1b rv / Gba1b MB03039 ) y Gba1b mutantesGba1b ΔTT / Gba1b MB03039 ). (B) Imagen representativa y cuantificación de Ref (2) P soluble. La transferencia de Western se realizó en fracciones solubles en Triton de Gba1b y controlar moscas (como arriba). Los experimentos se realizaron por lo menos tres veces. *pag & lt 0.05 por estudiante t prueba.


4. DISCUSIÓN

Los ratones adultos Rimkla - / - tienen niveles de NAAG muy reducidos en la mayoría de las regiones del cerebro. Debido a que no encontramos evidencia de expresión alterada del segundo gen de la NAAG sintetasa, Rimklb, y la NAA sintasa Nat8l, la NAAG restante en los ratones Rimkla - / - posiblemente corresponda a la cantidad sintetizada normalmente por NAAGS-I. En el hipocampo encontramos niveles reducidos de GCPII, que potencialmente podrían compensar parcialmente la síntesis reducida de NAAG. Por tanto, la contribución de NAAGS-I en el tipo salvaje puede ser incluso menor de lo esperado a partir de los valores medidos en ratones Rimkla - / -. La disminución relativa de NAAG fue más pronunciada en regiones que normalmente contienen niveles altos del péptido (por ejemplo, 8% del nivel de tipo salvaje en bulbo raquídeo, en comparación con 58% en la neocorteza). Por tanto, Rimkla parece expresarse especialmente en tipos de células / regiones cerebrales con una alta demanda de síntesis de NAAG, como, por ejemplo, neuronas motoras y células ganglionares de la retina. Este punto de vista está respaldado por una buena correlación entre los altos niveles de NAAGS-II demostrados en estas regiones del cerebro por Western blot informados aquí y la fuerte inmunorreactividad de anticuerpos NAAG previamente informada (Anderson et al., 1987 Moffett & Namboodiri, 2006).

Varios estudios indicaron que NAAG juega un papel en la memoria de trabajo a largo plazo y a corto plazo (para revisión: Neale & Olszewski, 2019). Un estudio reciente sugiere un papel de NAAG en este último que identificó una mutación de GCPII en humanos que condujo a una mayor actividad enzimática y, por lo tanto, redujo los niveles de NAAG y se asocia con déficits en la memoria de trabajo (Zink et al., 2020).Además, los ratones Shati / Nat8l - / - se ven afectados en una prueba de atención basada en objetos (Wulaer et al., 2020), aunque no está claro si esto se debe a una deficiencia en NAAG o su precursor NAA, que ambos se reducen en Nat8l - / - ratones. La memoria de trabajo intacta en ratones Rimkla - / -, como lo indica el rendimiento normal en el laberinto en T alterno espontáneo, no excluye un papel de NAAG en la memoria a corto plazo, pero puede indicar que se requiere la síntesis de NAAG dependiente de Rimklb / NAAGS-I o puede, en ese caso, compensar la pérdida de síntesis de NAAG dependiente de NAAGS-II.

Además de los estudios que muestran los efectos inhibidores de NAAG sobre la plasticidad sináptica (Adedoyin et al., 2010 Lea et al., 2001), hay varios informes que indican un papel procognitivo de NAAG en la memoria a largo plazo. Los inhibidores de la GCPII que degradan NAAG pueden prevenir déficits de cognición en diferentes modelos de ratones de enfermedades neurológicas o neurodegenerativas (Olszewski et al., 2012 Hicks et al., 2017 Zhu et al., 2017 para revisión: Vornov et al., 2016 Neale & Yamamoto , 2020). Además, la inhibición de GCPII fue suficiente para prevenir la inhibición del reconocimiento de objetos mediada por el antagonista del receptor de NMDA MK801 en una prueba NOR de retraso a corto plazo (1,5 h) (Olszewski et al., 2012). Además, la inhibición de GCPII por 2-PMPA o ZJ43 permitió a los ratones C57BL / 6 de tipo salvaje recordar el objeto familiar después de una prueba NOR de retraso de 24 horas, lo que generalmente no es el caso en estos ratones (Janczura et al., 2013). Por lo tanto, la concentración elevada de NAAG mejora los procesos de cognición y memoria y esto probablemente esté mediado por la activación de mGluR3, porque el antagonista de mGluR del grupo II LY341495 a menudo previene el efecto de los inhibidores de GCPII (Hicks et al., 2017 Olszewski et al., 2012 Zhu et al. ., 2017). Por otro lado, mostramos aquí que los niveles de NAAG significativamente reducidos (o la ausencia de NAAG) van acompañados de una cognición deteriorada en la prueba NOR. Por lo tanto, existe una clara correlación positiva entre el reconocimiento de objetos y la concentración de NAAG, lo que sugiere fuertemente que NAAG no solo juega un papel procognitivo en condiciones patológicas cuando su concentración aumenta artificialmente. Sin embargo, se ha informado de un contraejemplo para ratones Nat8l - / - de la línea de ratón deficiente en NAA sintasa Shati / Nat8l - / -. Estos ratones y en la misma medida sus controles de tipo salvaje mostraron un reconocimiento de objeto significativo después de un retraso de 24 horas (Furukawa-Hibi et al., 2012), en contraste con los controles de tipo salvaje en el estudio de Janczura et al. (2013). Es poco probable una influencia de los antecedentes genéticos, porque los ratones de ambos estudios tenían antecedentes C57BL / 6. Si estos resultados contradictorios pueden explicarse por la edad de los animales o por los protocolos específicos de las pruebas NOR, no está claro en la actualidad.

Está bien establecido que la consolidación de la memoria de la tarea NOR depende del hipocampo (Antunes & Biala, 2012). Un posible mecanismo de un papel específico de NAAG sintetizado NAAGS-II en la prueba NOR se sugiere por la observación de que en el hipocampo sólo parvalbúmina (un marcador para las interneuronas GABAérgicas) las neuronas positivas contienen cantidades detectables de NAAGS-II. De acuerdo con la localización de NAAGS-II, los estudios inmunohistoquímicos revelaron la presencia de NAAG en interneuronas pero no en células piramidales en el hipocampo (Neale et al., 2000). Por lo tanto, proponemos que la consolidación de memoria deteriorada en la tarea NOR en ratones Rimkla - / - puede ser la consecuencia de una entrada inhibitoria más fuerte de las interneuronas, causada por una activación reducida de mGluR3 presináptica en las sinapsis GABAérgicas. Según esta hipótesis, el reconocimiento de objetos mejorado observado en una tarea NOR a largo plazo de ratones de tipo salvaje tratados con inhibidores de GCPII (Janczura et al., 2013) podría explicarse por una inhibición más fuerte y duradera de la liberación de GABA por NAAG. Alternativamente, NAAG puede estar involucrado en la señalización retrógrada (Nordengen et al., 2020). La liberación dendrítica de NAAG de las interneuronas puede activar el mGluR3 presináptico de las sinapsis glutamatérgicas y, por lo tanto, inhibir la liberación de glutamato. Esto estaría en línea con la observación de que la inmunorreactividad del anticuerpo NAAG en la mayoría de las neuronas GABAérgicas, a diferencia de las neuronas glutamatérgicas, se encontró en las dendritas y los cuerpos celulares, pero no en los axones (Moffett y Namboodiri, 2006). Además del hipocampo, la corteza, en particular la corteza perirrinal, es esencial para el reconocimiento de objetos (Antunes y Biala, 2012) y las interneuronas inhibidoras corticales contienen NAAG (Moffet y Namboodiri, 2006). Aunque no pudimos detectar NAAGS-II en regiones corticales por inmunofluorescencia, pueden estar presentes niveles bajos (al menos en el neocórtex NAAGS-II fue detectable por Western Blot) y también pueden desempeñar un papel en la memoria del objeto.

Debido a que los ratones Rimkla - / - también exhiben una concentración más baja de NAA en algunas regiones del cerebro, incluida la neocorteza, no podemos descartar la posibilidad de que los déficits de memoria / cognición en los ratones Rimkla - / - y Nat8l - / - sean de hecho causados por deficiencia de NAA en lugar de NAAG. Sin embargo, actualmente no hay indicios de que NAA pueda servir como neurotransmisor. Hasta donde sabemos, no existe ningún receptor NAA ni evidencia de su liberación sináptica. Sin embargo, podría ser posible que las concentraciones reducidas de NAA en ratones Rimkla - / - reflejen la pérdida de neuronas, ya que NAA se considera generalmente como un marcador de salud neuronal (Moffett et al., 2014 Rigotti et al., 2007) y cognición los déficits son consecuencias secundarias.

No podemos descartar una posible explicación alternativa para un papel específico de Rimkla / NAAGS-II en NOR, es decir, una función específica de NAAG2, que solo es sintetizado por NAAGS-II y era indetectable en ratones Rimkla - / -. Los anticuerpos NAAG utilizados para demostrar la presencia de NAAG, por ejemplo, en la corteza y el hipocampo (Moffet y Namboodiri, 2006), por inmunhistoquímica pueden no distinguir entre NAAG y NAAG2 (Kozik et al., 2021). Además, NAAG2 es también un sustrato de GCPII (Lodder-Gadaczek et al., 2011) y, por lo tanto, las deficiencias en la tarea NOR en ratones Rimkla - / - o la mejora de la cognición tras la inhibición o deficiencia de GCPII podrían explicarse potencialmente por un papel específico de NAAG2. Sin embargo, actualmente no tenemos evidencia para apoyar esta hipótesis. Los experimentos de rescate transgénico en ratones Rimkla - / - que utilizan una combinación de Rimklb podrían ser una forma de abordar esta cuestión. Sin embargo, los ratones Rimkla - / - son un sistema modelo útil para explorar más a fondo el papel fisiológico de NAAG y NAAG2.