Información

¿Qué sucede exactamente si durante la traducción no hay un aminoácido presente?

¿Qué sucede exactamente si durante la traducción no hay un aminoácido presente?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Digamos que la célula quiere producir una proteína en particular. Se realiza la transcripción del gen apropiado y se elabora el ARNm. El ARNm se adhiere al ribosoma y la traducción se inicia de forma "normal".

¿Qué pasaría exactamente si falta un aminoácido requerido en la proteína? Sé que la proteína no se fabricaría correctamente, pero quiero saber exactamente qué pasaría con el ribosoma y el ARNm. ¿Están destruidos? ¿Están simplemente separados? ¿Quién regula esto?


No es cierto que el anticodón de un ARNt no cargado no pueda unirse al ARNm.

Las bacterias tienen un mecanismo llamado respuesta estricta. Esta respuesta es complicada, aquí hay una explicación más breve y simplificada. Se puede encontrar más información en las páginas de wikipedia vinculadas en el texto.

Si durante la traducción un determinado aminoácido está ausente, un ARNt no cargado se une al ribosoma, provocando la síntesis de la alarmona (p) ppGpp mediante la activación de la enzima RelA (en E. coli), asociada con la subunidad 50S del ribosoma. Los bloques de traducción y (p) ppGpp interactúan con la subunidad β de RNApol causando:

  1. la reducción de su afinidad por el factor de transcripción σ70 y, por tanto, la reducción de la transcripción de genes de ARNr;
  2. el aumento de su afinidad por σS y σN, factores de transcripción necesarios, respectivamente, para la adaptación en la fase estacionaria y la falta de N. También se potencia la biosíntesis de aminoácidos.

Una vez que se restablece la situación, la enzima SpoT (coli) hidroliza (p) ppGpp.


Punto a saber: el aminoacil-tRNA se une al mRNA, no es solo t-RNA ...

Entonces, si no hay aminoácido, no hay aminoacil-tRNA de ese aminoácido ... así que si no hay aminoacil-tRNA, el anticodón del tRNA no forma un enlace con el mRNA, por lo que la producción de proteínas se detiene (hasta que el Aminoácido producido).

Si la proteína no se forma dentro de un cierto tiempo, la proteína prematura se pliega y se rompe. Luego, una molécula (ejemplo: ubiquitina para cierto tipo de bacteria) se adhiere a esta proteína prematura y la marca para su degradación.

Pero aún existen posibilidades de producción de proteínas con ligeras mutaciones.

Mutación: el tRNA con el mismo anticodón y diferente aminoácido puede unirse fácilmente al sitio A del ribosoma en ausencia del aminoacil-tRNA correcto, por lo que la producción de proteína no se detiene en este caso, pero la proteína tiene una mutación con diferente aminoácido. .


¿Qué sucede exactamente si durante la traducción no hay un aminoácido presente? - biología

Figura 1. Un enlace peptídico une el extremo carboxilo de un aminoácido con el extremo amino de otro, expulsando una molécula de agua. Por simplicidad en esta imagen, solo se muestran los grupos funcionales involucrados en el enlace peptídico. Las designaciones R y R 'se refieren al resto de la estructura de cada aminoácido.

El proceso de traducción o síntesis de proteínas implica la decodificación de un mensaje de ARNm en un producto polipeptídico. Los aminoácidos se unen covalentemente mediante enlaces peptídicos entrelazados. Cada aminoácido individual tiene un grupo amino (NH2) y un grupo carboxilo (COOH). Los polipéptidos se forman cuando el grupo amino de un aminoácido forma un enlace amida (es decir, péptido) con el grupo carboxilo de otro aminoácido (Figura 1).

Esta reacción es catalizada por ribosomas y genera una molécula de agua.


Transferencia de ARN

La transferencia de ARN juega un papel muy importante en la síntesis y traducción de proteínas. Su trabajo es traducir el mensaje dentro de la secuencia de nucleótidos del ARNm a una secuencia de aminoácidos específica. Estas secuencias se unen para formar una proteína. El ARN de transferencia tiene la forma de una hoja de trébol con tres bucles. Contiene un sitio de unión de aminoácidos en un extremo y una sección especial en el bucle central llamada sitio anticodón. El anticodón reconoce un área específica en un ARNm llamada codón.


Alargamiento

El ribosoma tiene dos sitios de unión de tRNA el sitio P que contiene la cadena de péptidos y el sitio A que acepta el ARNt.

Mientras que la metionina-tRNA ocupa el sitio P, el aminoacil-tRNA que es complementario al siguiente codón se une al sitio A, utilizando la energía producida por la hidrólisis de GTP.

La metionina se mueve desde el sitio P al sitio A para unirse a un nuevo aminoácido allí, y así ha comenzado el crecimiento del péptido. La molécula de ARNt en el sitio P ya no tiene un aminoácido adjunto y, por lo tanto, abandona el ribosoma.

El ribosoma entonces transloca a lo largo de la molécula de ARNm hasta el siguiente codón, utilizando nuevamente la energía producida por la hidrólisis de GTP. Ahora, el péptido en crecimiento se encuentra en el sitio P y el sitio A está abierto para la unión del siguiente aminoacil-tRNA, y el ciclo continúa. La cadena polipeptídica se forma en la dirección desde el terminal N (metionina) al terminal C (el aminoácido final).

Figura 4 - Alargamiento de la cadena polipeptídica


ARN frente a ADN

Es tentador confundir el ARN con el ADN, pero son muy diferentes y es importante comprender estas diferencias. Ambos están formados por nucleótidos, que son las unidades básicas de los ácidos nucleicos (como el ADN y el ARN). Estos nucleótidos contienen un grupo fosfato, una base nitrogenada y una ribosa de azúcar de 5 carbonos.

Sin embargo, en lugar de la ribosa del ADN, el ARN usa desoxirribosa, un tipo diferente de azúcar. Además, el ARN suele ser de una sola hebra, mientras que el ADN es famoso de doble hebra. Finalmente, el ADN contiene timina, mientras que el ARN usa uracilo en su lugar.


Biología 171

Al final de esta sección, podrá hacer lo siguiente:

  • Describir los diferentes pasos en la síntesis de proteínas.
  • Discutir el papel de los ribosomas en la síntesis de proteínas.

La síntesis de proteínas consume más energía celular que cualquier otro proceso metabólico. A su vez, las proteínas representan más masa que cualquier otro componente de los organismos vivos (con la excepción del agua) y las proteínas realizan prácticamente todas las funciones de una célula. El proceso de traducción o síntesis de proteínas implica la decodificación de un mensaje de ARNm en un producto polipeptídico. Los aminoácidos se enlazan covalentemente mediante enlaces peptídicos entrelazados en longitudes que varían de aproximadamente 50 a más de 1000 residuos de aminoácidos. Cada aminoácido individual tiene un grupo amino (NH2) y un grupo carboxilo (COOH). Los polipéptidos se forman cuando el grupo amino de un aminoácido forma un enlace amida (es decir, péptido) con el grupo carboxilo de otro aminoácido ((Figura)). Esta reacción es catalizada por ribosomas y genera una molécula de agua.

La maquinaria de síntesis de proteínas

Además de la plantilla de ARNm, muchas moléculas y macromoléculas contribuyen al proceso de traducción. La composición de cada componente puede variar entre especies, por ejemplo, los ribosomas pueden consistir en diferentes números de ARNr y polipéptidos dependiendo del organismo. Sin embargo, las estructuras y funciones generales de la maquinaria de síntesis de proteínas son comparables de las bacterias a las células humanas. La traducción requiere la entrada de una plantilla de ARNm, ribosomas, ARNt y varios factores enzimáticos. (Nota: Se puede pensar en un ribosoma como una enzima cuyos sitios de unión de aminoácidos están especificados por el ARNm).

Haga clic en Taller de ADN: Síntesis de proteínas (página web) para ver la síntesis de proteínas en acción.

Ribosomas

Incluso antes de que se traduzca un ARNm, una célula debe invertir energía para construir cada uno de sus ribosomas. En E. coli, hay entre 10,000 y 70,000 ribosomas presentes en cada célula en un momento dado. Un ribosoma es una macromolécula compleja compuesta de ARNr estructurales y catalíticos, y muchos polipéptidos distintos. En eucariotas, el nucleolo está completamente especializado para la síntesis y ensamblaje de ARNr.

Los ribosomas existen en el citoplasma de los procariotas y en el citoplasma y el retículo endoplásmico rugoso de los eucariotas. Las mitocondrias y los cloroplastos también tienen sus propios ribosomas en la matriz y el estroma, que se parecen más a los ribosomas procarióticos (y tienen sensibilidades similares a los fármacos) que los ribosomas que se encuentran justo fuera de sus membranas externas en el citoplasma. Los ribosomas se disocian en subunidades grandes y pequeñas cuando no están sintetizando proteínas y se reasocian durante el inicio de la traducción. En E. coli, la subunidad pequeña se describe como 30S y la subunidad grande es 50S, para un total de 70S (recuerde que las unidades de Svedberg no son aditivas). Los ribosomas de mamíferos tienen una pequeña subunidad 40S y una gran subunidad 60S, para un total de 80S. La subunidad pequeña es responsable de unir la plantilla de ARNm, mientras que la subunidad grande se une secuencialmente a los ARNt. Cada molécula de ARNm es traducida simultáneamente por muchos ribosomas, todos sintetizando proteínas en la misma dirección: leyendo el ARNm de 5 & # 8242 a 3 & # 8242 y sintetizando el polipéptido desde el extremo N al terminal C. La estructura completa de ARNm / polirribosoma se denomina polisoma.

ARNt

Los ARNt son moléculas de ARN estructural que se transcribieron a partir de genes mediante la ARN polimerasa III. Dependiendo de la especie, existen de 40 a 60 tipos de ARNt en el citoplasma. Los ARN de transferencia sirven como moléculas adaptadoras. Cada ARNt lleva un aminoácido específico y reconoce uno o más de los codones del ARNm que definen el orden de los aminoácidos en una proteína. Los aminoacil-tRNA se unen al ribosoma y añaden el aminoácido correspondiente a la cadena polipeptídica. Por lo tanto, los ARNt son las moléculas que realmente "traducen" el lenguaje del ARN al lenguaje de las proteínas.

De los 64 posibles codones de ARNm, o combinaciones de tripletes de A, U, G y C, tres especifican la terminación de la síntesis de proteínas y 61 especifican la adición de aminoácidos a la cadena polipeptídica. De estos 61, un codón (AUG) también codifica el inicio de la traducción. Cada anticodón de ARNt puede emparejarse con uno o más de los codones de ARNm para su aminoácido. Por ejemplo, si la secuencia CUA ocurriera en una plantilla de ARNm en el marco de lectura adecuado, se uniría a un ARNt de leucina que expresa la secuencia complementaria, GAU. La capacidad de algunos ARNt para coincidir con más de un codón es lo que le da al código genético su estructura de bloques.

Como moléculas adaptadoras de la traducción, es sorprendente que los ARNt puedan encajar tanta especificidad en un paquete tan pequeño. Considere que los ARNt deben interactuar con tres factores: 1) deben ser reconocidos por la aminoacil sintetasa correcta (ver más abajo) 2) deben ser reconocidos por los ribosomas y 3) deben unirse a la secuencia correcta en el ARNm.

Aminoacil tRNA sintetasas

El proceso de síntesis de pre-ARNt por la ARN polimerasa III solo crea la porción de ARN de la molécula adaptadora. El aminoácido correspondiente debe agregarse más tarde, una vez que el tRNA se procesa y se exporta al citoplasma. A través del proceso de “carga” de tRNA, cada molécula de tRNA está ligada a su aminoácido correcto por una de un grupo de enzimas llamadas aminoacil tRNA sintetasas. Existe al menos un tipo de aminoacil tRNA sintetasa para cada uno de los 20 aminoácidos; el número exacto de aminoacil tRNA sintetasas varía según la especie. Estas enzimas primero se unen e hidrolizan el ATP para catalizar un enlace de alta energía entre un aminoácido y el monofosfato de adenosina (AMP), una molécula de pirofosfato es expulsada en esta reacción. Luego, el aminoácido activado se transfiere al ARNt y se libera AMP. El término & # 8220charging & # 8221 es apropiado, ya que el enlace de alta energía que une un aminoácido a su ARNt se usa más tarde para impulsar la formación del enlace peptídico. Cada ARNt se nombra por su aminoácido.

El mecanismo de síntesis de proteínas

Al igual que con la síntesis de ARNm, la síntesis de proteínas se puede dividir en tres fases: iniciación, alargamiento y terminación. El proceso de traducción es similar en procariotas y eucariotas. Aquí exploraremos cómo se produce la traducción en E. coli, un procariota representativo, y especificar las diferencias entre la traducción procariota y eucariota.

Inicio de la traducción

La síntesis de proteínas comienza con la formación de un complejo de iniciación. En E. coli, este complejo involucra el pequeño ribosoma 30S, la plantilla de ARNm, tres factores de iniciación (IF IF-1, IF-2 e IF-3) y un iniciador especial de ARNt, llamado ARNt Metf.

En E. coli El ARNm, una secuencia cadena arriba del primer codón AUG, llamada secuencia de Shine-Dalgarno (AGGAGG), interactúa con las moléculas de ARNr que componen el ribosoma. Esta interacción ancla la subunidad ribosómica 30S en la ubicación correcta en la plantilla de ARNm. El trifosfato de guanosina (GTP), que es un nucleótido trifosfato de purina, actúa como fuente de energía durante la traducción, tanto al inicio del alargamiento como durante la translocación del ribosoma. La unión del ARNm al ribosoma 30S también requiere IF-III.

El ARNt iniciador luego interactúa con el codón de inicio AUG (o raramente, GUG). Este ARNt transporta el aminoácido metionina, que se formila después de su unión al ARNt. La formilación crea un enlace peptídico & # 8220faux & # 8221 entre el grupo formil carboxilo y el grupo amino de la metionina. La unión del fMet-tRNA Metf está mediada por el factor de iniciación IF-2. El fMet comienza cada cadena polipeptídica sintetizada por E. coli, pero generalmente se elimina una vez completada la traducción. Cuando se encuentra un AUG en marco durante el alargamiento de la traducción, se inserta una metionina no formilada mediante un Met-tRNA Met normal. Después de la formación del complejo de iniciación, la subunidad ribosómica 30S se une a la subunidad 50S para formar el complejo de traducción. En eucariotas, se forma un complejo de iniciación similar, que comprende ARNm, la subunidad ribosómica pequeña 40S, IF eucariotas y nucleósidos trifosfatos (GTP y ATP). La metionina en el ARNt iniciador cargado, llamado Met-ARNtI, no está formilado. Sin embargo, Met-tRNAI se diferencia de otros Met-tRNA en que puede unirse a IF.

En lugar de depositarse en la secuencia de Shine-Dalgarno, el complejo de iniciación eucariota reconoce la tapa de 7-metilguanosina en el extremo 5 & # 8242 del ARNm. Una proteína de unión al casquete (CBP) y varias otras IF ayudan al movimiento del ribosoma al casquete 5 & # 8242. Una vez en el casquete, el complejo de iniciación sigue a lo largo del ARNm en la dirección 5 & # 8242 a 3 & # 8242, buscando el codón de inicio AUG. Muchos ARNm eucariotas se traducen del primer AUG, pero no siempre es así. Según las reglas de Kozak, los nucleótidos alrededor del AUG indican si es el codón de inicio correcto. Las reglas de Kozak establecen que la siguiente secuencia de consenso debe aparecer alrededor del AUG de los genes de los vertebrados: 5 & # 8242-gccRccAUGG-3 & # 8242. La R (para purina) indica un sitio que puede ser A o G, pero no puede ser C o U. Esencialmente, cuanto más cerca está la secuencia de este consenso, mayor es la eficiencia de la traducción.

Una vez que se identifica el AUG apropiado, las otras proteínas y CBP se disocian y la subunidad 60S se une al complejo de Met-tRNAI, ARNm y la subunidad 40S. Este paso completa el inicio de la traducción en eucariotas.

Traslación, alargamiento y terminación

En procariotas y eucariotas, los fundamentos del alargamiento son los mismos, por lo que repasaremos el alargamiento desde la perspectiva de E. coli. Cuando se forma el complejo de traducción, la región de unión del ARNt del ribosoma consta de tres compartimentos. El sitio A (aminoacilo) se une a los ARNt de aminoacilo cargados entrantes. El sitio P (peptidilo) se une a los ARNt cargados que llevan aminoácidos que han formado enlaces peptídicos con la cadena polipeptídica en crecimiento, pero que aún no se han disociado de su ARNt correspondiente. El sitio E (salida) libera ARNt disociados para que puedan recargarse con aminoácidos libres. El metionil-tRNA iniciador, sin embargo, ocupa el sitio P al comienzo de la fase de elongación de la traducción tanto en procariotas como en eucariotas.

Durante el alargamiento de la traducción, la plantilla de ARNm proporciona especificidad de unión a ARNt. A medida que el ribosoma se mueve a lo largo del ARNm, se registra cada codón de ARNm y se asegura la unión específica con el anticodón de ARNt cargado correspondiente. Si el ARNm no estuviera presente en el complejo de elongación, el ribosoma se uniría a los ARNt de forma inespecífica y aleatoria (?).

La elongación procede con ARNt cargados que entran y salen secuencialmente del ribosoma a medida que se agrega cada nuevo aminoácido a la cadena polipeptídica. El movimiento de un ARNt del sitio A al P al E es inducido por cambios conformacionales que hacen avanzar al ribosoma por tres bases en la dirección 3 & # 8242. La energía para cada paso a lo largo del ribosoma es donada por factores de elongación que hidrolizan el GTP. La energía GTP es necesaria tanto para la unión de un nuevo aminoacil-tRNA al sitio A como para su translocación al sitio P después de la formación del enlace peptídico. Los enlaces peptídicos se forman entre el grupo amino del aminoácido unido al ARNt del sitio A y el grupo carboxilo del aminoácido unido al ARNt del sitio P. La formación de cada enlace peptídico es catalizada por la peptidil transferasa, una enzima basada en ARN que está integrada en la subunidad ribosómica 50S. La energía para la formación de cada enlace peptídico se deriva del enlace de alta energía que une cada aminoácido a su ARNt. Después de la formación del enlace peptídico, el ARNt del sitio A que ahora contiene la cadena de péptidos en crecimiento se mueve al sitio P, y el ARNt del sitio P que ahora está vacío se mueve al sitio E y es expulsado del ribosoma ((Figura)). Sorprendentemente, el E. coli El aparato de traducción toma solo 0.05 segundos para agregar cada aminoácido, lo que significa que una proteína de 200 aminoácidos se puede traducir en solo 10 segundos.

Muchos antibióticos inhiben la síntesis de proteínas bacterianas. Por ejemplo, la tetraciclina bloquea el sitio A en el ribosoma bacteriano y el cloranfenicol bloquea la transferencia de peptidilo. ¿Qué efecto específico esperaría que tenga cada uno de estos antibióticos en la síntesis de proteínas?

La tetraciclina afectaría directamente:

El cloranfenicol afectaría directamente:

La terminación de la traducción ocurre cuando se encuentra un codón sin sentido (UAA, UAG o UGA). Al alinearse con el sitio A, estos codones sin sentido son reconocidos por factores de liberación de proteínas que se asemejan a los ARNt. Los factores de liberación tanto en procariotas como en eucariotas instruyen a la peptidil transferasa a agregar una molécula de agua al extremo carboxilo del aminoácido del sitio P. Esta reacción obliga al aminoácido del sitio P a separarse de su ARNt y se libera la proteína recién creada. Las subunidades ribosómicas pequeñas y grandes se disocian del ARNm y se reclutan entre sí casi de inmediato en otro complejo de iniciación de la traducción. Una vez que muchos ribosomas han completado la traducción, el ARNm se degrada para que los nucleótidos puedan reutilizarse en otra reacción de transcripción.

Plegamiento, modificación y focalización de proteínas

Durante y después de la traducción, los aminoácidos individuales pueden modificarse químicamente, agregarse secuencias señal y la nueva proteína "plegarse" en una estructura tridimensional distinta como resultado de interacciones intramoleculares. Una secuencia señal es una secuencia corta en el extremo amino de una proteína que la dirige a un compartimento celular específico. Estas secuencias pueden considerarse como el "boleto de tren" de la proteína hacia su destino final, y son reconocidas por proteínas de reconocimiento de señales que actúan como conductoras. Por ejemplo, un extremo de la secuencia de señal específica dirigirá una proteína a las mitocondrias o cloroplastos (en plantas). Una vez que la proteína llega a su destino celular, la secuencia de señal generalmente se corta.

Muchas proteínas se pliegan espontáneamente, pero algunas proteínas requieren moléculas auxiliares, llamadas acompañantes, para evitar que se agreguen durante el complicado proceso de plegado. Incluso si una proteína está correctamente especificada por su ARNm correspondiente, podría adoptar una forma completamente disfuncional si las condiciones anormales de temperatura o pH impiden que se pliegue correctamente.

Resumen de la sección

Los jugadores en la traducción incluyen la plantilla de ARNm, ribosomas, ARNt y varios factores enzimáticos. La subunidad ribosómica pequeña se une a la plantilla de ARNm en la secuencia de Shine-Dalgarno (procariotas) o en la tapa 5 & # 8242 (eucariotas). La traducción comienza en el AUG de inicio en el ARNm, especificando metionina. La formación de enlaces peptídicos se produce entre aminoácidos secuenciales emparejados con la plantilla de ARNm por sus ARNt de acuerdo con el código genético. Los ARNt cargados ingresan al sitio ribosómico A y sus aminoácidos se unen con el aminoácido en el sitio P. El ARNm completo se traduce en "pasos" de tres nucleótidos del ribosoma. Cuando se encuentra un codón sin sentido, un factor de liberación se une y disocia los componentes y libera la nueva proteína. El plegamiento de la proteína ocurre durante y después de la traducción.

Conexiones de arte

(Figura) Muchos antibióticos inhiben la síntesis de proteínas bacterianas. Por ejemplo, la tetraciclina bloquea el sitio A en el ribosoma bacteriano y el cloranfenicol bloquea la transferencia de peptidilo. ¿Qué efecto específico esperaría que tenga cada uno de estos antibióticos en la síntesis de proteínas?

La tetraciclina afectaría directamente:

El cloranfenicol afectaría directamente

(Figura) Tetraciclina: a Cloranfenicol: c.

Respuesta libre

Transcriba y traduzca la siguiente secuencia de ADN (cadena sin plantilla): 5 & # 8242-ATGGCCGGTTATTAAGCA-3 & # 8242

El ARNm sería: 5 & # 8242-AUGGCCGGUUAUUAAGCA-3 & # 8242. La proteína sería: MAGY. Aunque hay seis codones, el quinto codón corresponde a una parada, por lo que el sexto codón no se traduciría.

Explique cómo los cambios de un solo nucleótido pueden tener efectos muy diferentes sobre la función de las proteínas.

Es posible que los cambios de nucleótidos en la tercera posición de los codones no cambien el aminoácido y no tengan ningún efecto sobre la proteína. Otros cambios de nucleótidos que cambian aminoácidos importantes o crean o eliminan codones de inicio o parada tendrían efectos severos en la secuencia de aminoácidos de la proteína.

Un ARNm normal que lee 5 ’- UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ tiene una mutación de inserción que cambia la secuencia a 5 ’-UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3 '. Traduzca el ARNm original y el ARNm mutado, y explique cómo las mutaciones de inserción pueden tener efectos dramáticos en las proteínas. (Sugerencia: asegúrese de encontrar el sitio de iniciación).

ARNm original: 5 ’–UGCC AUG GUA AUA ACA CAU GAG GCC UGA AC– 3’

Traducción: Met - Val - Ile - Thr - His - Glu - Ala

ARNm mutado: 5 '–UGCC AUG GUU AAU AAC ACA UGA GGCCUGAAC– 3 '

Traducción: Met - Val - Asn - Asn - Thr

Las mutaciones de inserción pueden tener efectos dramáticos en las proteínas porque cambian el marco de lectura de los codones. Esto cambia los aminoácidos codificados por el ARNm y puede introducir sitios de inicio o parada prematuros.

Glosario

Enzima aminoacil tRNA sintetasa que "carga" moléculas de tRNA catalizando un enlace entre el tRNA y el correspondiente iniciador de aminoácidos tRNA en procariotas, llamado en eucariotas, llamado ARNtI un ARNt que interactúa con un codón de inicio, se une directamente al sitio del ribosoma P y se une a una metionina especial para comenzar una cadena polipeptídica Las reglas de Kozak determinan el AUG de iniciación correcto en un ARNm eucariota, la siguiente secuencia de consenso debe aparecer alrededor del AUG: 5 '-GCC (purina) CCAGOGRAMO-3 'las bases en negrita son la enzima más importante basada en ARN de la peptidil transferasa que está integrada en la subunidad ribosómica 50S y cataliza la formación de enlaces peptídicos La molécula de ARNm del polisoma es traducida simultáneamente por muchos ribosomas que van en la misma dirección secuencia Shine-Dalgarno ( AGGAGG) inicia la traducción procariótica al interactuar con moléculas de ARNr que comprenden la secuencia de señal del ribosoma 30S cola corta de aminoácidos que dirige una proteína a un codón de inicio de compartimento celular específico AUG (o raramente, GUG) en un ARNm a partir del cual comienza la traducción siempre especifica metionina

Marco de lectura abierto

Una vez que se identifica el codón de inicio, cada grupo secuencial de tres pares de bases forma el siguiente codón. De esta manera, la posición del codón de inicio determina el marco de lectura abierto, o el orden de los codones que se leerán para formar la proteína. En el siguiente ejemplo, una vez que el ribosoma se ensambla en el primer AUG, el orden del resto de los codones se establece para el resto de la traducción del ARNm.


Traducción de código genético y aminoácidos

La Tabla 1 muestra el código genético del ácido ribonucleico mensajero (ARNm), es decir, muestra las 64 combinaciones posibles de codones compuestos por tres bases nucleotídicas (unidades trinucleotídicas) que especifican los aminoácidos durante el ensamblaje de proteínas.

Cada codón del ácido desoxirribonucleico (ADN) codifica o especifica un solo aminoácido y cada unidad de nucleótidos consta de un fosfato, azúcar desoxirribosa y una de las 4 bases de nucleótidos nitrogenados, adenina (A), guanina (G), citosina (C ) y timina (T). Las bases están emparejadas y unidas por enlaces de hidrógeno en la doble hélice del ADN. El ARNm corresponde al ADN (es decir, la secuencia de nucleótidos es la misma en ambas cadenas) excepto que en el ARN, la timina (T) se reemplaza por uracilo (U) y la desoxirribosa se reemplaza por ribosa.

El proceso de traducción de información genética en el ensamblaje de una proteína requiere primero ARNm, que se lee de 5 'a 3' (exactamente como ADN), y luego transferir ácido ribonucleico (ARNt), que se lee de 3 'a 5'. El tRNA es el taxi que traduce la información del ribosoma en una cadena de aminoácidos o polipéptido.

Para el ARNm hay 4 3 = 64 combinaciones de nucleótidos diferentes posibles con un codón triplete de tres nucleótidos. Las 64 combinaciones posibles se muestran en la Tabla 1. Sin embargo, no todos los 64 codones del código genético especifican un solo aminoácido durante la traducción. La razón es que en los humanos solo 20 aminoácidos (excepto la selenocisteína) están involucrados en la traducción. Por lo tanto, un aminoácido puede ser codificado por más de un triplete de codones de ARNm. La arginina y la leucina están codificadas por 6 tripletes, la isoleucina por 3, la metionina y el triptófano por 1 y todos los demás aminoácidos por 4 o 2 codones. Los codones redundantes son típicamente diferentes en la 3ª base. La Tabla 2 muestra la asignación inversa de codones, es decir, qué codón especifica cuál de los 20 aminoácidos estándar implicados en la traducción.

Tabla 1. Código genético: codón de ARNm -> aminoácido

1er
Base
2do
Base
Tercero
Base
U C A GRAMO
U Fenilalanina Serina Tirosina Cisteína U
Fenilalanina Serina Tirosina Cisteína C
Leucina Serina Parada Parada A
Leucina Serina Parada Triptófano GRAMO
C Leucina Prolina Histidina Arginina U
Leucina Prolina Histidina Arginina C
Leucina Prolina Glutamina Arginina A
Leucina Prolina Glutamina Arginina GRAMO
A Isoleucina Treonina Asparagina Serina U
Isoleucina Treonina Asparagina Serina C
Isoleucina Treonina Lisina Arginina A
Metionina (inicio) 1 Treonina Lisina Arginina GRAMO
GRAMO Valina Alanina Aspartato Glicina U
Valina Alanina Aspartato Glicina C
Valina Alanina Glutamato Glicina A
Valina Alanina Glutamato Glicina GRAMO

Tabla 2. Tabla de codones inversos: aminoácido -> codón de ARNm

Aminoácidos codones de ARNm Aminoácidos codones de ARNm
Ala / A GCU, GCC, GCA, GCG Leu / L UUA, UUG, CUU, CUC, CUA, CUG
Arg / R CGU, CGC, CGA, CGG, AGA, AGG Lys / K AAA, AAG
Asn / N AAU, AAC Met / M AGO
Asp / D GAU, GAC Phe / F UUU, UUC
Cys / C UGU, UGC Apuntalar CCU, CCC, CCA, CCG
Gln / Q CAA, CAG Ser / S UCU, UCC, UCA, UCG, AGU, AGC
Pegamento GAA, GAG Thr / T ACU, ACC, ACA, ACG
Gly / G GGU, GGC, GGA, GGG Trp / W UGG
Su / H CAU, CAC Tyr / Y UAU, UAC
Ile / I AUU, AUC, AUA Val / V GUU, GUC, GUA, GUG
COMIENZO AGO PARADA UAG, UGA, UAA

La dirección de lectura del ARNm es de 5 'a 3'. El ARNt (lectura de 3 'a 5') tiene anticodones complementarios a los codones en el ARNm y se puede "cargar" covalentemente con aminoácidos en su terminal 3 '. Según Crick, la unión de los pares de bases entre el codón del ARNm y el anticodón del ARNt tiene lugar solo en la 1ª y 2ª base. La unión en la tercera base (es decir, en el extremo 5 'del anticodón del ARNt) es más débil y puede dar como resultado pares diferentes. Para que la unión entre el codón y el anticodón se haga realidad, las bases deben salirse de sus posiciones en el ribosoma. Por lo tanto, los pares de bases a veces se denominan pares oscilantes.

La Tabla 3 muestra los posibles pares de oscilación en la 1ª, 2ª y 3ª base. Las posibles combinaciones de pares en la 1ª y 2ª base son idénticas. En la tercera base (es decir, en el extremo 3 'del ARNm y el extremo 5' del ARNt), las posibles combinaciones de pares son menos inequívocas, lo que conduce a la redundancia en el ARNm. La desaminación (eliminación del grupo amino NH2) de adenosina (no confundir con adenina) produce el nucleótido inosina (I) en el ARNt, que genera pares oscilantes no estándar con U, C o A (pero no con G) en el ARNm. La inosina puede aparecer en la 3ª base del ARNt.

Tabla 3. Pares de bases: codón de ARNm -> anticodón de ARNt

La Tabla 3 se lee de la siguiente manera: para el primer y segundo par de bases, los pares de oscilación proporcionan unicidad en la forma en que U en el ARNt siempre emerge de A en el ARNm, A en el ARNt siempre emerge de U en el ARNm, etc. el tercer par de bases, el código genético es redundante en la forma en que U en el ARNt puede emerger de A o G en el ARNm, G en el ARNt puede emerger de U o C en el ARNm e I en el ARNt puede emerger de U, C o A en ARNm. Solo A y C en el tercer lugar en el ARNt se asignan de manera inequívoca a U y G en el tercer lugar en el ARNm, respectivamente.

Debido a esta estructura de combinación, un ARNt puede unirse a diferentes codones de ARNm donde los codones de ARNm sinónimos o redundantes difieren en la 3ª base (es decir, en el extremo 5 'del ARNt y el extremo 3' del ARNm). Según esta lógica, el número mínimo de anticodones de ARNt necesarios para codificar todos los aminoácidos se reduce a 31 (excluyendo los 2 codones de PARADA AUU y ACU, ver Tabla 5). Esto significa que cualquier anticodón de ARNt puede estar codificado por uno o más codones de ARNm diferentes (Tabla 4). Sin embargo, hay más de 31 anticodones de ARNt posibles para la traducción de los 64 codones de ARNm. Por ejemplo, la serina tiene un sitio degenerado cuádruple en la tercera posición (UCU, UCC, UCA, UCG), que puede ser traducido por AGI (para UCU, UCC y UCA) y AGC en tRNA (para UCG) pero también por AGG y AGU. Esto significa, a su vez, que cualquier codón de ARNm también puede ser traducido por uno o más anticodones de ARNt (ver Tabla 5).

La razón de la aparición de diferentes pares de oscilaciones que codifican el mismo aminoácido puede deberse a un compromiso entre la velocidad y la seguridad en la síntesis de proteínas. La redundancia de codones de ARNm existe para evitar errores en la transcripción causados ​​por mutaciones o variaciones en la 3ª posición pero también en otras posiciones. Por ejemplo, la primera posición de los codones de leucina (UCA, UCC, CCU, CCC, CCA, CCG) es un sitio degenerado doble, mientras que la segunda posición es inequívoca (no redundante). Otro ejemplo es la serina con codones de ARNm UCA, UCG, UCC, UCU, AGU, AGC. Por supuesto, la serina también está doblemente degenerada en la primera posición y cuádruple en la tercera posición, pero además está doblemente degenerada en la segunda posición. La Tabla 4 muestra la asignación de codones de ARNm a cualquier posible anticodón de ARNt en eucariotas para los 20 aminoácidos estándar implicados en la traducción. Es la asignación del codón inverso.

Tabla 4. Codificación inversa de aminoácidos: aminoácido -> anticodón de ARNt -> codón de ARNm

Si bien no es posible predecir un codón de ADN específico a partir de un aminoácido, los codones de ADN se pueden decodificar sin ambigüedades en aminoácidos. La razón es que hay 61 codones de ADN (y ARNm) diferentes que especifican solo 20 aminoácidos. Tenga en cuenta que hay 3 codones adicionales para la terminación de la cadena, es decir, hay 64 codones de ADN (y por lo tanto 64 ARNm diferentes), pero solo 61 de ellos especifican aminoácidos.

La Tabla 5 muestra el código genético para la traducción de los 64 codones de ADN, comenzando desde el ADN sobre el ARNm y el ARNt hasta el aminoácido. En la última columna, la tabla muestra los diferentes anticodones de ARNt mínimamente necesarios para traducir todos los codones de ADN en aminoácidos y suma el número en la última fila. Revela que el número mínimo de anticodones de ARNt para traducir todos los codones de ADN es 31 (más 2 codones de PARADA). El número máximo de anticodones de tRNA que pueden surgir en la transcripción de aminoácidos es 70 (más 3 codones STOP).

Tabla 5. Código genético: ADN -> codón de ARNm -> anticodón de ARNt -> aminoácido

Nota:
1 El codón AUG codifica la metionina y sirve como sitio de inicio: el primer AUG en la región codificante de un ARNm es donde comienza la traducción a proteína.


La síntesis de proteínas es más fácil en 26 preguntas y respuestas

Las características de los organismos dependen de las reacciones químicas que ocurren en su interior. Estas reacciones son catalizadas por enzimas, que son proteínas muy específicas. Cada proteína de un organismo está hecha de información contenida en moléculas de ARN, que se elaboran de acuerdo con una plantilla basada en una secuencia de nucleótidos de una cadena de ADN.

Un gen es una secuencia de polinucleótidos de ADN que contiene información para la producción de una proteína.

ARN y ribosomas

4. ¿Cuál es el papel del ARN mensajero y los ribosomas en la síntesis de proteínas?

El ARN mensajero (ARNm) se produce dentro del núcleo de una célula y migra al citoplasma, donde se adhiere a los ribosomas y guía la construcción de las secuencias de aminoácidos que compondrán las proteínas. Los ribosomas son sitios para la reunión y unión de ARNm y ARN de transferencia (ARNt). Son las estructuras donde los aminoácidos transportados por el ARNt se unen mediante enlaces peptídicos para formar cadenas polipeptídicas (proteínas).

5. ¿Qué subunidades componen los ribosomas?

Los ribosomas están formados por dos subunidades, la subunidad pequeña y la subunidad grande. Estas subunidades están formadas por ARN ribosómico (ARNr) y proteínas. Los ribosomas tienen tres sitios de unión, uno para el ARNm y dos para el ARNt.

6. ¿Qué tan diferente es la ubicación de los ribosomas en células eucariotas y procariotas?

En los procariotas, los ribosomas se encuentran libres en el citoplasma. En las células eucariotas, también se pueden encontrar libres en el citoplasma, pero se unen principalmente a la membrana externa de la carioteca y al retículo endoplásmico rugoso.

7. ¿Cómo se explica la presencia de ribosomas dentro de las mitocondrias y los cloroplastos?

Una hipótesis bien sustentada afirma que las mitocondrias y los cloroplastos eran procariotas que desarrollaron una relación de mutualismo con las células eucariotas (obteniendo protección y ofreciendo energía). Esto explica por qué estos orgánulos contienen ADN y maquinaria de síntesis de proteínas, incluidos los ribosomas. Esta hipótesis se conoce como la hipótesis endosimbiótica sobre el origen de las mitocondrias y los cloroplastos.

8. ¿Cuáles son algunos ejemplos de células humanas que producen proteínas para la exportación? ¿Qué orgánulo citoplasmático debe estar bien desarrollado y ser abundante en esas células?

Las células especializadas de las glándulas, como las células de Langerhans del páncreas (que producen insulina) o las células productoras de saliva, son ejemplos de células secretoras. En las células especializadas en secreción, el retículo endoplásmico y el aparato de Golgi están bien desarrollados, ya que participan en el almacenamiento y procesamiento de proteínas para la exportación.

9. ¿Qué ribosomas abundan más en las células secretoras, los ribosomas libres en el citoplasma o los adheridos al retículo endoplásmico rugoso?

Los ribosomas libres en el citoplasma están más relacionados con la producción de proteínas para el consumo celular interno, mientras que los adheridos al retículo endoplásmico rugoso son más importantes en la síntesis de proteínas para la exportación. Las proteínas producidas por los ribosomas adheridos ingresan al retículo endoplásmico rugoso y luego se transfieren al aparato de Golgi. Por tanto, en las células secretoras, los ribosomas adheridos al retículo endoplásmico son más abundantes.

Seleccione cualquier pregunta para compartirla en FB o Twitter

Simplemente seleccione (o haga doble clic) en una pregunta para compartir. Desafía a tus amigos de Facebook y Twitter.

Traducción de proteínas y ARN mensajero

10. ¿En qué parte de las células eucariotas se produce la síntesis de ARNm? ¿A dónde migran estas moléculas?

Las moléculas de ARN mensajero se sintetizan dentro del núcleo, atraviesan los poros de la membrana nuclear y entran al citoplasma para llegar a los ribosomas donde se produce la síntesis de proteínas.

11. Dado que se basa en información del ARNm, ¿cómo se llama el proceso de síntesis de proteínas?

La síntesis de proteínas se llama traducción (de información genética a proteínas).

12. ¿Cuál es la diferencia entre transcripción y traducción?

Transcripción es el nombre que se le da a la formación de moléculas de ARN a partir de una cadena de ADN abierta que se utiliza como plantilla. La traducción es la creación de polipéptidos (aminoácidos unidos en secuencia) y, por lo tanto, de proteínas basadas en información codificada en la molécula de ARNm.

En las células eucariotas, la transcripción ocurre en el núcleo y la traducción ocurre en los ribosomas. La transcripción precede a la traducción.

13. ¿Cómo codifican los nucleótidos de las cadenas de ARNm la información para la formación de las secuencias de aminoácidos de una proteína?

Solo hay cuatro tipos de bases nitrogenadas que pueden componer nucleótidos de ARN: adenina (A), uracilo (U), guanina (G) y citosina (C). Sin embargo, hay 20 aminoácidos diferentes. Con un solo nucleótido (una codificación 1: 1), sería imposible codificar todos los aminoácidos.

Con dos nucleótidos, habría una disposición de 4 elementos, 2 x 2, resultando en un total de solo 16 posibles unidades codificadoras (4 x 4). La naturaleza puede conocer el análisis combinatorio, ya que ha creado un código genético ordenando las 4 bases de ARN, 3 x 3, proporcionando 64 tripletes diferentes (4 x 4 x 4).

Por lo tanto, cada triplete de bases nitrogenadas de ARN codifica un aminoácido de una proteína. A medida que estos tripletes aparecen en secuencia en la molécula de ARN, los aminoácidos secuenciales codificados por ellos se unen para formar cadenas polipeptídicas. Por ejemplo, una secuencia UUU codifica el aminoácido fenilalanina, así como la secuencia UUC las secuencias ACU, ACC, ACA y ACG codifican el aminoácido treonina y así sucesivamente para todas las posibles secuencias de tripletes y todos los demás aminoácidos.

14. ¿Cómo se llama una secuencia de ARN que codifica un aminoácido?

Cada secuencia de tres bases nitrogenadas de ARN que codifica un aminoácido se denomina codón. El codón es la unidad codificadora del código genético.

15. Dado que de los 64 codones del ARNm, 61 codifican aminoácidos que forman cadenas polipeptídicas, ¿cuáles son las funciones de los tres codones restantes?

Dado que hay 20 aminoácidos y 64 posibilidades de codones de ARNm, algunos aminoácidos codifican más de un codón.

Sin embargo, no todos los 64 codones codifican aminoácidos. Tres de ellos, UAA, UGA y UAG, transmiten la información de que se ha unido el último aminoácido de la cadena polipeptídica, señalando el final de la síntesis polipeptídica. Estos codones se denominan codones de terminación. El codón AUG codifica el aminoácido metionina y, al mismo tiempo, señala el inicio de la síntesis de una cadena polipeptídica (es un codón de inicio).

En las células procariotas, existe una secuencia denominada secuencia de Shine-Dalgarno (en general AGGAGG) en la posición anterior al codón de inicio AUG. La función de esta secuencia es distinguir el codón de inicio AUG y los otros codones AUG del ARN.

16. ¿A qué estructura celular se unen las moléculas de ARNm para iniciar la síntesis de proteínas?

Para producir proteínas, las moléculas de ARNm deben unirse a los ribosomas. Los ribosomas tienen dos sitios para la unión de dos codones de ARNm vecinos y donde los anticodones de ARNt se unen por enlace de hidrógeno. Por tanto, los ribosomas son la estructura responsable del posicionamiento y exposición de los codones de ARNm a traducir. En los ribosomas también se produce el enlace peptídico entre dos aminoácidos provocado por moléculas de ARNt. El enlace peptídico ocurre cuando las moléculas de ARNt que llevan aminoácidos se unen a los codones de ARNm expuestos.

17. ¿Cómo se llevan los aminoácidos a los sitios de la célula donde tiene lugar la traducción? ¿Qué es un anticodón?

Los aminoácidos son llevados a los ribosomas por moléculas de ARN conocidas como ARN de transferencia o ARNt. Un ARNt unido a su aminoácido específico se une mediante una secuencia especial de tres nucleótidos a un codón de ARNm expuesto en el ribosoma. Esta secuencia en el ARNt se conoce como anticodón. El anticodón del ARNt debe ser complementario del codón del ARNm al que se une, según la regla A-U, C-G. Luego, el ribosoma se desliza a lo largo de la molécula de ARNm (un proceso llamado translocación) para exponer el siguiente codón para la unión de otro ARNt. Cuando los aminoácidos correspondientes a los codones vecinos se unen por enlace peptídico, se libera la primera molécula de tRNa.

18. ¿Por qué es importante la proximidad entre los ribosomas y los aminoácidos para la formación de proteínas? ¿Cuál es la enzima que cataliza esa reacción?

La proximidad entre los ribosomas y los aminoácidos es importante porque la enzima que cataliza el enlace peptídico reside en los ribosomas. Como sustratos de estas enzimas, los aminoácidos necesitan unirse a los centros de activación de las enzimas.

La enzima que cataliza el enlace peptídico es la peptidil transferasa.

19. ¿Por qué los ribosomas se mueven a lo largo del ARNm durante la traducción?

Durante la traducción, el ribosoma siempre expone dos codones de ARNm para ser traducidos moviéndose a lo largo del ARNm. Cuando se forma un enlace peptídico, el ribosoma se mueve para exponer el siguiente codón. Este movimiento se llama translocación ribosómica. (En el retículo endoplásmico rugoso, los ribosomas están unidos fuera de la membrana y las moléculas de ARNm se mueven a través de ellos).

20. ¿Cuántas de las mismas proteínas son producidas al mismo tiempo por cada ribosoma durante la traducción de una molécula de ARNm? ¿Cómo se produce la producción consecutiva de proteínas en la traducción?

Los ribosomas no producen varias proteínas diferentes simultáneamente. Los hacen uno tras otro.

Sin embargo, muchos ribosomas pueden moverse a lo largo de una molécula de ARNm, produciendo en masa la misma proteína. La unidad formada por muchos ribosomas que trabajan en la misma molécula de ARNm se llama polisoma.

Síntesis de proteínas - Diversidad de imágenes: polisoma

21. ¿Una molécula de ARNm codifica solo un tipo de proteína?

Las células eucariotas tienen ARNm monocistrónico, lo que significa que cada ARNm codifica solo una cadena polipeptídica. Los procariotas pueden presentar ARNm policistrónico.

Después de ensamblar los aminoácidos en una cadena polipeptídica, el ARNm, a través de uno de sus codones de terminación, envía una señal al ribosoma de que el polipéptido está completo. El ribosoma luego libera la proteína producida. En los procariotas, una vez finalizado este proceso, la información sobre el inicio de la síntesis de otra proteína diferente puede seguir en la misma molécula de ARNm.

22. Si un anticodón de ARNt es CAA, ¿cuál es su codón de ARNm correspondiente? En el código genético, ¿qué aminoácido codifica este codón?

Según la regla A-U, C-G, el codón que corresponde al anticodón CAA es GUU.

La tabla de códigos genéticos para la traducción se basa en codones y no en anticodones. El aminoácido codificado por GUU, según el código genético, es la valina.

23. Si un fragmento de ácido nucleico tiene una secuencia de nucleótidos de TAC, ¿es un codón o un anticodón?

Un fragmento de ácido nucleico con una secuencia TAC seguramente no es ARNt. Es ADN porque el ARN no contiene la base nitrogenada timina. Dado que no es ARN, no puede ser un codón o un anticodón.

La universalidad del código genético

24. ¿Por qué se puede llamar al código genético un "código degenerado"?

El código genético es un código degenerado porque algunos aminoácidos están codificados por más de un tipo de codón. No es un sistema en el que cada elemento esté codificado por una sola unidad de codificación.

Por ejemplo, el aminoácido arginina está codificado por seis codones: CGU, CGC, CGA, CGG, AGA y AGG.

25. ¿Cuál es el concepto de universalidad del código genético? ¿Cuáles son las excepciones a esta universalidad?

El código genético es universal porque las reglas de codificación de proteínas basadas en codones de ARNm son prácticamente las mismas para todos los organismos vivos conocidos. Por ejemplo, el código genético es el mismo para humanos, bacterias e invertebrados.

sin embargo, la síntesis de proteínas en las mitocondrias, los cloroplastos y algunos protozoos se logra mediante una codificación genética diferente.

26. ¿Cómo hace posible la universalidad del código genético la tecnología del ADN recombinante?

La universalidad del código genético se refiere al hecho de que la maquinaria de síntesis de proteínas de todos los organismos vivos funciona de acuerdo con los mismos principios de almacenamiento, transmisión y reconocimiento de información, incluida la traducción de codones de ARNm. Este hecho hace posible el intercambio de genes o fragmentos de genes entre diferentes organismos y asegura que estos genes continúen controlando la síntesis de proteínas.

Esta universalidad, por ejemplo, hace factible la inserción de un fragmento de ADN humano que contiene un gen para la producción de una determinada proteína en el material genético de las bacterias. Dado que los sistemas de transcripción y traducción bacterianos funcionan de la misma manera que los sistemas humanos correspondientes, las bacterias comenzarán a sintetizar la proteína humana asociada con el fragmento de ADN insertado. Existen industrias que producen insulina humana (para uso de diabéticos) de esta manera, sintetizada por bacterias con ADN modificado. Si el código genético no fuera universal, este tipo de manipulación genética sería imposible o muy difícil de lograr sin nuevos avances tecnológicos.

Ahora que ha terminado de estudiar Síntesis de proteínas, estas son sus opciones:


SÍNTESIS DE PROTEÍNAS

Durante la síntesis de proteínas, generalmente se evitan errores al agregar aminoácidos a la cadena polipeptídica en crecimiento. Si no es así, un mecanismo de control de calidad asegura la terminación prematura de secuencias erróneas.

Para que las células prosperen, el código genético debe traducirse con gran precisión en los aminoácidos de los que están hechas las proteínas. Durante la traducción, la fábrica de síntesis de proteínas de la célula & # x02014 el ribosoma & # x02014 monitorea cuidadosamente el proceso mediante el cual se agregan nuevos aminoácidos a una cadena polipeptídica en crecimiento. Para cada uno, un trinucleótido específico (un codón) en el ARN mensajero se empareja con un anticodón complementario en un ARN de transferencia, que en su otro extremo lleva el aminoácido correspondiente. Una vez que se han formado los pares de codón y anticodón, el aminoácido se une químicamente a la cadena polipeptídica mediante un enlace peptídico. En este punto, se pensó que las funciones de control de calidad del ribosoma estaban más o menos completas. Pero Zaher y Green 1 presentan evidencia en este número (página 161) de que, incluso después de la formación de enlaces peptídicos, el ribosoma puede detectar desajustes de codón & # x02013anticodon y reacciona llevando la síntesis de proteína & # x02019s a un final prematuro.

El emparejamiento de codones y anticodones por el ribosoma es un proceso complicado, que implica una cierta cantidad de margen (Watson & # x02013Crick bamboleo) para permitir la lectura de los 64 codones que componen el código genético. Por lo tanto, no es sorprendente que, a pesar de un emparejamiento cuidadoso, a veces se cometan errores, lo que da como resultado proteínas mal dobladas o no funcionales que deben replegarse o destruirse una vez finalizada la traducción. Durante la síntesis de proteínas, generalmente se cree que los errores ocurren a una tasa de aproximadamente 1 de cada 20.000 aminoácidos, aunque los niveles pueden ser más altos o más bajos dependiendo de las condiciones 2, 3. Los estudios en diferentes sistemas vivos apoyan esta tasa de error estimada, mientras que los experimentos con componentes individuales de la maquinaria de síntesis de proteínas in vitro han arrojado resultados menos claros.

Fue uno de esos experimentos que despertó el interés de Zaher y Green & # x02019. Al observar la formación de péptidos simples de dos aminoácidos, a veces vieron tasas de error tan altas como 1 en 2000 & # x02014 un orden de magnitud más alto de lo que esperaban. Para explorar más a fondo estas altas tasas de error, recurrieron a un error ocasional que está bien documentado en los sistemas vivos: la traducción errónea del codón AAU en el aminoácido lisina, en lugar de asparagina. También comenzaron a observar la formación de péptidos más largos de hasta cuatro aminoácidos. Para su sorpresa, encontraron que, una vez que se ha cometido un error, el ribosoma se vuelve mucho menos eficiente para agregar aminoácidos. Entonces, en lugar de continuar creciendo, la cadena de péptidos naciente se liberó prematuramente de la maquinaria de traducción.

Los ribosomas contienen tres sitios de unión para sus sustratos de ARNt: el sitio aminoacil (A), el sitio peptidilo (P) y el sitio de salida (E). Durante cada ronda de elongación de la cadena de aminoácidos, el apareamiento de codón y anticodón permite la entrada del ARNt correcto en el sitio A (Fig. 1a). La cadena polipeptídica naciente unida al ARNt en el sitio P se transfiere luego al ARNt que lleva un nuevo aminoácido en el sitio A, alargando así la cadena en un residuo. Este ciclo de adición de aminoácidos se completa cuando el tRNA originalmente en el sitio P se mueve al sitio E y el tRNA en el sitio A se desplaza al sitio P, liberando el sitio A para el siguiente tRNA (Fig. 1a). Las translocaciones de ARNt van acompañadas de un movimiento de ARNm por tres nucleótidos & # x02014 o un codón & # x02014 hacia el sitio E. Se producen ciclos iterativos de alargamiento hasta que un codón de parada, que indica el final, llega al sitio A. El reconocimiento específico de este codón por un factor de liberación primario (conocido como proteínas RF en la bacteria Escherichia coli) promueve la hidrólisis del polipéptido ahora maduro del ARNt del sitio P, un proceso llamado terminación 4.

aNormalmente, el tRNA correcto (amarillo) entra en el sitio A del ribosoma y el aminoácido apropiado (rojo) se incorpora a la cadena de péptidos en crecimiento, que se transfiere del tRNA en el sitio P al tRNA en el sitio A. Both tRNAs, as well as the mRNA, then shift towards the E site. B, When mistakes are made and the mismatched codon𠄺nticodon helix (indicated by a red cross) translocates to the P site, the ribosomal complex becomes susceptible to premature termination by translation factors such as RF2, and the erroneous sequence is prematurely released.

In an effort to understand their puzzling observations, Zaher and Green 1 studied several defined ribosomal complexes, made from purified components, in vitro. They find that complexes containing a mismatch between the anticodon and codon in the P site are susceptible to RF2-mediated peptide release, despite the absence of a stop codon in the A site ( Fig. 1b ). Although slow, this reaction was stimulated considerably by the secondary release factor RF3, suggesting that it might be relevant en vivo, where both RFs are present.

Intriguingly, a sequence containing a mismatched codon𠄺nticodon pair in the P site also stimulated further error — that is, incorporation of an amino acid despite the absence of correct codon𠄺nticodon pairing 1 . Consequently, complexes containing codon𠄺nticodon mismatches were made in both the E and P sites. Again, the authors observed high rates of RF-dependent peptide release in these complexes, suggesting that termination can efficiently compete with elongation. The net effect is that miscoding errors terminate translation prematurely, which is another means of quality control by the ribosome — retrospectively, following peptide-bond formation — to increase the fraction of functional proteins made.

How codon𠄺nticodon mismatches in the P site (or P and E sites) stimulate further miscoding and peptide release remains unclear. Codon𠄺nticodon pairing in these sites normally helps to maintain the correct reading of codons on mRNA. Mismatches could disrupt such systematic reading of mRNA, potentially allowing various codons to transiently occupy the A site as the mRNA slides through the ribosome unpaired. Another possibility is that mismatches generate a conformational signal in the ribosomal complex that alters the activities of the translation factors such as RF proteins. Indeed, earlier work 5 - 7 showed that conformational changes in the ribosome regulate both the decoding of mRNA and its termination. Regardless of the precise mechanism involved, Zaher and Green’s work 1 reveals a facet of quality control in protein synthesis that depends on an unanticipated level of complexity in the workings of the ribosome.


What is a nonsense mutation?

Mutations can occur in the body for a variety of reasons, including the environment, ultraviolet light, or an error in the nucleotide sequence of the DNA molecule. A mutation that gives rise to a nonsense or stop codon in the mRNA transcript is called a nonsense mutation.

A nonsense mutation is a point mutation where a single nucleotide is replaced by another nucleotide. The new sequence codes for a stop signal, which causes the amino acid formation to stop prematurely. This releases a shortened protein that might function differently.

The tRNA translates any codon triplet without rectifying the previous mistake. In the case of a nonsense mutation, the nucleotide change always codes for a stop codon. The stop codons UAG, UGA or UAA signal the tRNA to halt protein synthesis and the protein will then be prematurely released from the t-RNA machinery. This shortened protein sequence may get degraded by the cell due to its untimely release and lack of appropriate function.

It is important to note that mutations occurring in the body are random and cannot be attributed to a single reason. Sometimes, mutations lead to variety in our DNA, while at other times the end product might be somewhat undesirable. Most often, the result of a nonsense mutation is a non-functional protein, but whatever the case may be, mutations help us appreciate the level of sophistication with which our DNA is made.